EMAIL THIS PAGE TO A FRIEND

CLRN1

clarin 1

89 Gene Product Result for
Synonyms: RP61 USH3 USH3A
UniProtKB ID: P58418, D3DNJ3, E1ACU9, Q8N6A9
Gene ID:
Human(7401) Summary: This gene encodes a protein that contains a cytosolic N-terminus, multiple helical transmembrane domains, and an endoplasmic reticulum membrane retention signal, TKGH, in the C-terminus. The encoded protein may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIIa. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(229320) clarin 1
Rat(261738) clarin 1
cow(538836) clarin 1
dog(611756) clarin 1
chicken(771718) clarin 1
sheep(101118841) clarin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052995 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052995 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052995 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153386 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153386 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153386 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052995 Rosetta Predictions human pricing
NM_174878 Rosetta Predictions human pricing
NM_174880 Rosetta Predictions human pricing
NM_153299 Rosetta Predictions rat pricing
NM_153384 Rosetta Predictions mouse pricing
NM_153385 Rosetta Predictions mouse pricing
NM_153386 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204179 predicted 717
2 SASI_Hs01_00204181 predicted 886
3 SASI_Hs01_00204182 predicted 880
4 SASI_Hs01_00204183 predicted 886
5 SASI_Hs01_00204184 predicted 715
6 SASI_Hs01_00204185 predicted 717
7 SASI_Hs01_00204186 predicted 859
8 SASI_Hs01_00204187 predicted 845
9 SASI_Hs02_00361809 predicted 606
10 SASI_Hs02_00361810 predicted 864
11 SASI_Hs01_00204178 predicted 872
12 SASI_Hs01_00204180 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203675 predicted 597
2 SASI_Hs01_00203676 predicted 980
3 SASI_Hs01_00203677 predicted 636
4 SASI_Hs01_00203679 predicted 561
5 SASI_Hs01_00203680 predicted 969
6 SASI_Hs01_00203681 predicted 894
7 SASI_Hs01_00203682 predicted 946
8 SASI_Hs01_00203683 predicted 733
9 SASI_Hs01_00203684 predicted 513
10 SASI_Hs02_00368747 predicted 972
11 SASI_Hs01_00203678 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061721 predicted 567
2 SASI_Hs01_00061722 predicted 533
3 SASI_Hs01_00061723 predicted 532
4 SASI_Hs01_00061724 predicted 599
5 SASI_Hs01_00061725 predicted 529
6 SASI_Hs01_00061726 predicted 565
7 SASI_Hs01_00061727 predicted 592
8 SASI_Hs01_00061728 predicted 560
9 SASI_Hs01_00061729 predicted 538
10 SASI_Hs01_00061730 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153299 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113001 predicted 356
2 SASI_Rn01_00113002 predicted 315
3 SASI_Rn01_00113003 predicted 326
4 SASI_Rn02_00268944 predicted 277
5 SASI_Rn01_00113004 predicted 350
6 SASI_Rn01_00113006 predicted 198
7 SASI_Rn01_00113007 predicted 199
8 SASI_Rn01_00113008 predicted 203
9 SASI_Rn01_00113009 predicted 318
10 SASI_Rn01_00113010 predicted 270
11 SASI_Rn01_00113005 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023677 predicted 1032
2 SASI_Mm01_00023669 predicted 1112
3 SASI_Mm01_00023670 predicted 1090
4 SASI_Mm01_00023672 predicted 1231
5 SASI_Mm01_00023673 predicted 1085
6 SASI_Mm01_00023674 predicted 1106
7 SASI_Mm01_00023678 predicted 1048
8 SASI_Mm01_00023675 predicted 1163
9 SASI_Mm02_00343144 predicted 531
10 SASI_Mm02_00343145 predicted 836
11 SASI_Mm01_00023671 predicted 1094
12 SASI_Mm01_00023676 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163223 predicted 971
2 SASI_Mm01_00163215 predicted 1052
3 SASI_Mm01_00163216 predicted 1036
4 SASI_Mm01_00163218 predicted 1181
5 SASI_Mm01_00163219 predicted 1035
6 SASI_Mm01_00163220 predicted 1044
7 SASI_Mm01_00163224 predicted 990
8 SASI_Mm01_00163221 predicted 1100
9 SASI_Mm02_00343146 predicted 481
10 SASI_Mm02_00343147 predicted 785
11 SASI_Mm01_00163217 predicted 1037
12 SASI_Mm01_00163222 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121236 predicted 791
2 SASI_Mm01_00121228 predicted 871
3 SASI_Mm01_00121229 predicted 861
4 SASI_Mm01_00121231 predicted 996
5 SASI_Mm01_00121232 predicted 852
6 SASI_Mm01_00121233 predicted 868
7 SASI_Mm01_00121237 predicted 814
8 SASI_Mm01_00121234 predicted 925
9 SASI_Mm02_00343148 predicted 598
10 SASI_Mm02_00343149 predicted 766
11 SASI_Mm01_00121230 predicted 859
12 SASI_Mm01_00121235 predicted 870
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052995
CLRN1 MISSION shRNA Bacterial Glycerol Stock
clarin 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052995.2-879s1c1
Sequence:CCGGCCCTCATATAATAGGTTTGAACTCGAGTTCAAACCTATTATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052995.2-476s1c1
Sequence:CCGGCTCTGCCATCCTTATTGTGTTCTCGAGAACACAATAAGGATGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052995.2-477s1c1
Sequence:CCGGTCTGCCATCCTTATTGTGTTACTCGAGTAACACAATAAGGATGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052995.2-602s1c1
Sequence:CCGGCTGTGGCTGTCTTGTCATGATCTCGAGATCATGACAAGACAGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052995.2-455s1c1
Sequence:CCGGCCACGTCAATGTCATTCTCTTCTCGAGAAGAGAATGACATTGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052995.2-673s21c1
Sequence:CCGGATTATAAAGAAGGGACTTATGCTCGAGCATAAGTCCCTTCTTTATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052995.2-725s21c1
Sequence:CCGGCTCATTCTGGCTGACTAAAGGCTCGAGCCTTTAGTCAGCCAGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052995
CLRN1 MISSION shRNA shRNA Plasmid DNA
clarin 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052995.2-879s1c1
Sequence:CCGGCCCTCATATAATAGGTTTGAACTCGAGTTCAAACCTATTATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052995.2-476s1c1
Sequence:CCGGCTCTGCCATCCTTATTGTGTTCTCGAGAACACAATAAGGATGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052995.2-477s1c1
Sequence:CCGGTCTGCCATCCTTATTGTGTTACTCGAGTAACACAATAAGGATGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052995.2-602s1c1
Sequence:CCGGCTGTGGCTGTCTTGTCATGATCTCGAGATCATGACAAGACAGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052995.2-455s1c1
Sequence:CCGGCCACGTCAATGTCATTCTCTTCTCGAGAAGAGAATGACATTGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052995.2-673s21c1
Sequence:CCGGATTATAAAGAAGGGACTTATGCTCGAGCATAAGTCCCTTCTTTATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052995.2-725s21c1
Sequence:CCGGCTCATTCTGGCTGACTAAAGGCTCGAGCCTTTAGTCAGCCAGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052995
CLRN1 MISSION shRNA Lentiviral Transduction Particles
clarin 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052995.2-879s1c1
Sequence:CCGGCCCTCATATAATAGGTTTGAACTCGAGTTCAAACCTATTATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052995.2-476s1c1
Sequence:CCGGCTCTGCCATCCTTATTGTGTTCTCGAGAACACAATAAGGATGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052995.2-477s1c1
Sequence:CCGGTCTGCCATCCTTATTGTGTTACTCGAGTAACACAATAAGGATGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052995.2-602s1c1
Sequence:CCGGCTGTGGCTGTCTTGTCATGATCTCGAGATCATGACAAGACAGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052995.2-455s1c1
Sequence:CCGGCCACGTCAATGTCATTCTCTTCTCGAGAAGAGAATGACATTGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052995.2-673s21c1
Sequence:CCGGATTATAAAGAAGGGACTTATGCTCGAGCATAAGTCCCTTCTTTATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052995.2-725s21c1
Sequence:CCGGCTCATTCTGGCTGACTAAAGGCTCGAGCCTTTAGTCAGCCAGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153386
CLRN1 MISSION shRNA Bacterial Glycerol Stock
clarin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153386.2-794s1c1
Sequence:CCGGGCCCTCCTTATGTTATGTTTACTCGAGTAAACATAACATAAGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153386.2-660s1c1
Sequence:CCGGCCACTAATGTAGCTTCAGATTCTCGAGAATCTGAAGCTACATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153386.2-605s1c1
Sequence:CCGGCTGATACGACTTGCTGGATTTCTCGAGAAATCCAGCAAGTCGTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153386.2-432s1c1
Sequence:CCGGGTGGCTGTCTTGTCATGATATCTCGAGATATCATGACAAGACAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153386.2-218s1c1
Sequence:CCGGCTGAGCTTTCTCTGTGCTCTTCTCGAGAAGAGCACAGAGAAAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153386
CLRN1 MISSION shRNA shRNA Plasmid DNA
clarin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153386.2-794s1c1
Sequence:CCGGGCCCTCCTTATGTTATGTTTACTCGAGTAAACATAACATAAGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153386.2-660s1c1
Sequence:CCGGCCACTAATGTAGCTTCAGATTCTCGAGAATCTGAAGCTACATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153386.2-605s1c1
Sequence:CCGGCTGATACGACTTGCTGGATTTCTCGAGAAATCCAGCAAGTCGTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153386.2-432s1c1
Sequence:CCGGGTGGCTGTCTTGTCATGATATCTCGAGATATCATGACAAGACAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153386.2-218s1c1
Sequence:CCGGCTGAGCTTTCTCTGTGCTCTTCTCGAGAAGAGCACAGAGAAAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153386
CLRN1 MISSION shRNA Lentiviral Transduction Particles
clarin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153386.2-794s1c1
Sequence:CCGGGCCCTCCTTATGTTATGTTTACTCGAGTAAACATAACATAAGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153386.2-660s1c1
Sequence:CCGGCCACTAATGTAGCTTCAGATTCTCGAGAATCTGAAGCTACATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153386.2-605s1c1
Sequence:CCGGCTGATACGACTTGCTGGATTTCTCGAGAAATCCAGCAAGTCGTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153386.2-432s1c1
Sequence:CCGGGTGGCTGTCTTGTCATGATATCTCGAGATATCATGACAAGACAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153386.2-218s1c1
Sequence:CCGGCTGAGCTTTCTCTGTGCTCTTCTCGAGAAGAGCACAGAGAAAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks