EMAIL THIS PAGE TO A FRIEND

CLRN2

clarin 2

UniProtKB ID: A0PK11
Gene ID:
Human(645104) Summary: This gene belongs to the clarin family of genes. The clarins appear to belong to a large superfamily of small integral membrane glycoproteins with four transmembrane domains. The exact function of this gene is unknown. [provided by RefSeq, Oct 2008]
Mouse(624224) clarin 2
Rat(689515) clarin 2
dog(610779) clarin 2
cow(617290) clarin 2
sheep(101108133) clarin 2
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001079827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001079827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001079827 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079827 Rosetta Predictions human pricing
XM_928140 Rosetta Predictions human pricing
XM_001071050 Rosetta Predictions rat pricing
XM_888750 Rosetta Predictions mouse pricing
XM_912529 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313840 predicted 557
2 SASI_Hs02_00313841 predicted 595
3 SASI_Hs02_00313842 predicted 250
4 SASI_Hs02_00313843 predicted 596
5 SASI_Hs02_00313844 predicted 441
6 SASI_Hs02_00313845 predicted 553
7 SASI_Hs02_00313846 predicted 558
8 SASI_Hs02_00313847 predicted 380
9 SASI_Hs02_00313848 predicted 217
10 SASI_Hs02_00313849 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248408 predicted 266
2 SASI_Hs01_00248409 predicted 310
3 SASI_Hs01_00248410 predicted 315
4 SASI_Hs01_00248411 predicted 316
5 SASI_Hs01_00248412 predicted 240
6 SASI_Hs01_00248413 predicted 270
7 SASI_Hs01_00248414 predicted 273
8 SASI_Hs01_00248415 predicted 295
9 SASI_Hs01_00248416 predicted 261
10 SASI_Hs01_00248417 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071050 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333670 predicted 459
2 SASI_Rn02_00333671 predicted 345
3 SASI_Rn02_00333672 predicted 452
4 SASI_Rn02_00333673 predicted 468
5 SASI_Rn02_00333674 predicted 469
6 SASI_Rn02_00333675 predicted 404
7 SASI_Rn02_00333676 predicted 328
8 SASI_Rn02_00333677 predicted 332
9 SASI_Rn02_00333678 predicted 204
10 SASI_Rn02_00333679 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00428684 predicted 334
2 SASI_Mm02_00428685 predicted 625
3 SASI_Mm02_00428686 predicted 641
4 SASI_Mm02_00428687 predicted 236
5 SASI_Mm02_00428688 predicted 661
6 SASI_Mm02_00428689 predicted 398
7 SASI_Mm02_00428690 predicted 515
8 SASI_Mm02_00428691 predicted 408
9 SASI_Mm02_00428692 predicted 643
10 SASI_Mm02_00428693 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437166 predicted 334
2 SASI_Mm02_00437167 predicted 633
3 SASI_Mm02_00437168 predicted 642
4 SASI_Mm02_00437169 predicted 233
5 SASI_Mm02_00437170 predicted 660
6 SASI_Mm02_00437171 predicted 397
7 SASI_Mm02_00437172 predicted 519
8 SASI_Mm02_00437173 predicted 410
9 SASI_Mm02_00437174 predicted 639
10 SASI_Mm02_00437175 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001079827
CLRN2 MISSION shRNA Bacterial Glycerol Stock
clarin 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079827.2-339s21c1
Sequence:CCGGCCAATCCCAATTCACGATCTTCTCGAGAAGATCGTGAATTGGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079827.2-596s21c1
Sequence:CCGGCGGAACGAATCGCCAACTTTCCTCGAGGAAAGTTGGCGATTCGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079827.2-565s21c1
Sequence:CCGGTTCGTGGCTGCGGTGAAATTTCTCGAGAAATTTCACCGCAGCCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079827.2-386s21c1
Sequence:CCGGCAGGCCTTCATGTGATGATTCCTCGAGGAATCATCACATGAAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079827.2-447s21c1
Sequence:CCGGCATGGGCTTTGCCATTCTTAACTCGAGTTAAGAATGGCAAAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001079827
CLRN2 MISSION shRNA shRNA Plasmid DNA
clarin 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079827.2-339s21c1
Sequence:CCGGCCAATCCCAATTCACGATCTTCTCGAGAAGATCGTGAATTGGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079827.2-596s21c1
Sequence:CCGGCGGAACGAATCGCCAACTTTCCTCGAGGAAAGTTGGCGATTCGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079827.2-565s21c1
Sequence:CCGGTTCGTGGCTGCGGTGAAATTTCTCGAGAAATTTCACCGCAGCCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079827.2-386s21c1
Sequence:CCGGCAGGCCTTCATGTGATGATTCCTCGAGGAATCATCACATGAAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079827.2-447s21c1
Sequence:CCGGCATGGGCTTTGCCATTCTTAACTCGAGTTAAGAATGGCAAAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001079827
CLRN2 MISSION shRNA Lentiviral Transduction Particles
clarin 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079827.2-339s21c1
Sequence:CCGGCCAATCCCAATTCACGATCTTCTCGAGAAGATCGTGAATTGGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079827.2-596s21c1
Sequence:CCGGCGGAACGAATCGCCAACTTTCCTCGAGGAAAGTTGGCGATTCGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079827.2-565s21c1
Sequence:CCGGTTCGTGGCTGCGGTGAAATTTCTCGAGAAATTTCACCGCAGCCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079827.2-386s21c1
Sequence:CCGGCAGGCCTTCATGTGATGATTCCTCGAGGAATCATCACATGAAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079827.2-447s21c1
Sequence:CCGGCATGGGCTTTGCCATTCTTAACTCGAGTTAAGAATGGCAAAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks