EMAIL THIS PAGE TO A FRIEND

CLRN3

clarin 3

Synonyms: TMEM12 USH3AL1
UniProtKB ID: Q8NCR9, Q6MZX8
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152311 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152311 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152311 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178669 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178669 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178669 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160061 MISSION® esiRNA esiRNA human CLRN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152311 Rosetta Predictions human pricing
NM_001014026 Rosetta Predictions rat pricing
NM_178669 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122169 predicted 710
2 SASI_Hs01_00122170 predicted 278
3 SASI_Hs01_00122172 predicted 693
4 SASI_Hs01_00122173 predicted 864
5 SASI_Hs01_00122174 predicted 627
6 SASI_Hs01_00122175 predicted 466
7 SASI_Hs01_00122176 predicted 267
8 SASI_Hs01_00122177 predicted 330
9 SASI_Hs01_00122178 predicted 680
10 SASI_Hs02_00365896 predicted 880
11 SASI_Hs01_00122171 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014026 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041814 predicted 644
2 SASI_Rn01_00041815 predicted 1242
3 SASI_Rn01_00041816 predicted 353
4 SASI_Rn01_00041817 predicted 1055
5 SASI_Rn01_00041818 predicted 611
6 SASI_Rn01_00041819 predicted 1234
7 SASI_Rn01_00041820 predicted 951
8 SASI_Rn01_00041821 predicted 1066
9 SASI_Rn01_00041822 predicted 215
10 SASI_Rn01_00041823 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045552 predicted 1198
2 SASI_Mm01_00045553 predicted 667
3 SASI_Mm01_00045554 predicted 390
4 SASI_Mm01_00045555 predicted 634
5 SASI_Mm01_00045556 predicted 283
6 SASI_Mm01_00045557 predicted 1262
7 SASI_Mm01_00045558 predicted 795
8 SASI_Mm01_00045559 predicted 1260
9 SASI_Mm01_00045560 predicted 1271
10 SASI_Mm01_00045561 predicted 380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152311
CLRN3 MISSION shRNA Bacterial Glycerol Stock
clarin 3
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000421165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152311.3-425s21c1
Sequence:CCGGACTCTGCATTCGGTGACTATCCTCGAGGATAGTCACCGAATGCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152311.3-225s21c1
Sequence:CCGGTCATTGTAATTTGCTCTATTCCTCGAGGAATAGAGCAAATTACAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152311
CLRN3 MISSION shRNA shRNA Plasmid DNA
clarin 3
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000421165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152311.3-425s21c1
Sequence:CCGGACTCTGCATTCGGTGACTATCCTCGAGGATAGTCACCGAATGCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152311.3-225s21c1
Sequence:CCGGTCATTGTAATTTGCTCTATTCCTCGAGGAATAGAGCAAATTACAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152311
CLRN3 MISSION shRNA Lentiviral Transduction Particles
clarin 3
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000421165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152311.3-425s21c1
Sequence:CCGGACTCTGCATTCGGTGACTATCCTCGAGGATAGTCACCGAATGCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152311.3-225s21c1
Sequence:CCGGTCATTGTAATTTGCTCTATTCCTCGAGGAATAGAGCAAATTACAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178669
CLRN3 MISSION shRNA Bacterial Glycerol Stock
clarin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178669.3-628s1c1
Sequence:CCGGGCTTTATCCAGATACCACAAACTCGAGTTTGTGGTATCTGGATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178669.3-661s1c1
Sequence:CCGGCCACACTTACGGATACTCGTTCTCGAGAACGAGTATCCGTAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178669.3-478s1c1
Sequence:CCGGCAACAGCATCAGCAACCCTTACTCGAGTAAGGGTTGCTGATGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178669.3-200s1c1
Sequence:CCGGGTTGTTGTCATCTGCTCCATTCTCGAGAATGGAGCAGATGACAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178669.3-1801s1c1
Sequence:CCGGCCCTCCATTGTAGAACACTAACTCGAGTTAGTGTTCTACAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178669
CLRN3 MISSION shRNA shRNA Plasmid DNA
clarin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178669.3-628s1c1
Sequence:CCGGGCTTTATCCAGATACCACAAACTCGAGTTTGTGGTATCTGGATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178669.3-661s1c1
Sequence:CCGGCCACACTTACGGATACTCGTTCTCGAGAACGAGTATCCGTAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178669.3-478s1c1
Sequence:CCGGCAACAGCATCAGCAACCCTTACTCGAGTAAGGGTTGCTGATGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178669.3-200s1c1
Sequence:CCGGGTTGTTGTCATCTGCTCCATTCTCGAGAATGGAGCAGATGACAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178669.3-1801s1c1
Sequence:CCGGCCCTCCATTGTAGAACACTAACTCGAGTTAGTGTTCTACAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178669
CLRN3 MISSION shRNA Lentiviral Transduction Particles
clarin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178669.3-628s1c1
Sequence:CCGGGCTTTATCCAGATACCACAAACTCGAGTTTGTGGTATCTGGATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178669.3-661s1c1
Sequence:CCGGCCACACTTACGGATACTCGTTCTCGAGAACGAGTATCCGTAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178669.3-478s1c1
Sequence:CCGGCAACAGCATCAGCAACCCTTACTCGAGTAAGGGTTGCTGATGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178669.3-200s1c1
Sequence:CCGGGTTGTTGTCATCTGCTCCATTCTCGAGAATGGAGCAGATGACAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178669.3-1801s1c1
Sequence:CCGGCCCTCCATTGTAGAACACTAACTCGAGTTAGTGTTCTACAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks