EMAIL THIS PAGE TO A FRIEND

CLSPN

claspin

Gene ID:
Human(63967) Summary: The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Mouse(269582) claspin
Rat(298534) claspin
chicken(428223) claspin
cow(508363) claspin
dog(482481) claspin
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022111 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022111 Rosetta Predictions human pricing
NM_001106687 Rosetta Predictions rat pricing
NM_175554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147154 predicted 220
2 SASI_Hs01_00147155 predicted 3262
3 SASI_Hs02_00355503 predicted 1608
4 SASI_Hs02_00355504 predicted 2579
5 SASI_Hs01_00147156 predicted 3338
6 SASI_Hs01_00147157 predicted 2947
7 SASI_Hs01_00147158 predicted 3173
8 SASI_Hs01_00147159 predicted 3305
9 SASI_Hs01_00147160 predicted 3687
10 SASI_Hs01_00147161 predicted 1551
11 SASI_Hs01_00147152 predicted 1376
12 SASI_Hs01_00147153 predicted 2434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106687 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221398 predicted 3057
2 SASI_Rn02_00221399 predicted 815
3 SASI_Rn02_00221400 predicted 3404
4 SASI_Rn02_00221401 predicted 774
5 SASI_Rn02_00221402 predicted 3666
6 SASI_Rn02_00221403 predicted 797
7 SASI_Rn02_00221404 predicted 280
8 SASI_Rn02_00221405 predicted 2706
9 SASI_Rn02_00221406 predicted 1036
10 SASI_Rn02_00221407 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123173 predicted 1093
2 SASI_Mm01_00123174 predicted 908
3 SASI_Mm01_00123175 predicted 3857
4 SASI_Mm01_00123176 predicted 754
5 SASI_Mm01_00123177 predicted 2655
6 SASI_Mm01_00123178 predicted 4066
7 SASI_Mm01_00123179 predicted 2369
8 SASI_Mm01_00123180 predicted 3629
9 SASI_Mm02_00346518 predicted 210
10 SASI_Mm02_00346519 predicted 2352
11 SASI_Mm01_00123172 predicted 1655
12 SASI_Mm01_00123181 predicted 1110
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022111
VALIDATED
CLSPN MISSION shRNA Bacterial Glycerol Stock
claspin
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022111.2-4221s1c1
Sequence:CCGGGCAGACAGAAATTCCAGTGATCTCGAGATCACTGGAATTTCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_022111.2-3708s1c1
Sequence:CCGGGCCAAGAAAGTTACAGCCAAACTCGAGTTTGGCTGTAACTTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022111.2-3402s1c1
Sequence:CCGGGATGATGATAAGCGACAGCTACTCGAGTAGCTGTCGCTTATCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_022111.2-468s1c1
Sequence:CCGGCCTTGCTTAGAGCTGAGTCTTCTCGAGAAGACTCAGCTCTAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128461    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022111.2-4210s1c1
Sequence:CCGGGCAATAAGATTGCAGACAGAACTCGAGTTCTGTCTGCAATCTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-1729s21c1
Sequence:CCGGCAGTGAATGTGAACGTCATAGCTCGAGCTATGACGTTCACATTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-3312s21c1
Sequence:CCGGGAATATGAAGAGGACGTAATTCTCGAGAATTACGTCCTCTTCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-1023s21c1
Sequence:CCGGCATGATTTCTTCAAACGTAAACTCGAGTTTACGTTTGAAGAAATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-3744s21c1
Sequence:CCGGGCCAGTCGCCCTATGGTTATTCTCGAGAATAACCATAGGGCGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-4068s21c1
Sequence:CCGGACGCGAAGCATCTTCAAATATCTCGAGATATTTGAAGATGCTTCGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-951s21c1
Sequence:CCGGAGTGAGACTCAGCGCCTTATTCTCGAGAATAAGGCGCTGAGTCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-1074s21c1
Sequence:CCGGGCACTATTGAAGTCATCTAAACTCGAGTTTAGATGACTTCAATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022111.2-4150s21c1
Sequence:CCGGTAGCACTGAAAGTTGGAATTGCTCGAGCAATTCCAACTTTCAGTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022111
VALIDATED
CLSPN MISSION shRNA shRNA Plasmid DNA
claspin
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022111.2-4221s1c1
Sequence:CCGGGCAGACAGAAATTCCAGTGATCTCGAGATCACTGGAATTTCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_022111.2-3708s1c1
Sequence:CCGGGCCAAGAAAGTTACAGCCAAACTCGAGTTTGGCTGTAACTTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022111.2-3402s1c1
Sequence:CCGGGATGATGATAAGCGACAGCTACTCGAGTAGCTGTCGCTTATCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_022111.2-468s1c1
Sequence:CCGGCCTTGCTTAGAGCTGAGTCTTCTCGAGAAGACTCAGCTCTAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128461    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022111.2-4210s1c1
Sequence:CCGGGCAATAAGATTGCAGACAGAACTCGAGTTCTGTCTGCAATCTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-1729s21c1
Sequence:CCGGCAGTGAATGTGAACGTCATAGCTCGAGCTATGACGTTCACATTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-3312s21c1
Sequence:CCGGGAATATGAAGAGGACGTAATTCTCGAGAATTACGTCCTCTTCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-1023s21c1
Sequence:CCGGCATGATTTCTTCAAACGTAAACTCGAGTTTACGTTTGAAGAAATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-3744s21c1
Sequence:CCGGGCCAGTCGCCCTATGGTTATTCTCGAGAATAACCATAGGGCGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-4068s21c1
Sequence:CCGGACGCGAAGCATCTTCAAATATCTCGAGATATTTGAAGATGCTTCGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-951s21c1
Sequence:CCGGAGTGAGACTCAGCGCCTTATTCTCGAGAATAAGGCGCTGAGTCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-1074s21c1
Sequence:CCGGGCACTATTGAAGTCATCTAAACTCGAGTTTAGATGACTTCAATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022111.2-4150s21c1
Sequence:CCGGTAGCACTGAAAGTTGGAATTGCTCGAGCAATTCCAACTTTCAGTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022111
VALIDATED
CLSPN MISSION shRNA Lentiviral Transduction Particles
claspin
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022111.2-4221s1c1
Sequence:CCGGGCAGACAGAAATTCCAGTGATCTCGAGATCACTGGAATTTCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_022111.2-3708s1c1
Sequence:CCGGGCCAAGAAAGTTACAGCCAAACTCGAGTTTGGCTGTAACTTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022111.2-3402s1c1
Sequence:CCGGGATGATGATAAGCGACAGCTACTCGAGTAGCTGTCGCTTATCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_022111.2-468s1c1
Sequence:CCGGCCTTGCTTAGAGCTGAGTCTTCTCGAGAAGACTCAGCTCTAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128461    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022111.2-4210s1c1
Sequence:CCGGGCAATAAGATTGCAGACAGAACTCGAGTTCTGTCTGCAATCTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-1729s21c1
Sequence:CCGGCAGTGAATGTGAACGTCATAGCTCGAGCTATGACGTTCACATTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-3312s21c1
Sequence:CCGGGAATATGAAGAGGACGTAATTCTCGAGAATTACGTCCTCTTCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-1023s21c1
Sequence:CCGGCATGATTTCTTCAAACGTAAACTCGAGTTTACGTTTGAAGAAATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-3744s21c1
Sequence:CCGGGCCAGTCGCCCTATGGTTATTCTCGAGAATAACCATAGGGCGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-4068s21c1
Sequence:CCGGACGCGAAGCATCTTCAAATATCTCGAGATATTTGAAGATGCTTCGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-951s21c1
Sequence:CCGGAGTGAGACTCAGCGCCTTATTCTCGAGAATAAGGCGCTGAGTCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022111.2-1074s21c1
Sequence:CCGGGCACTATTGAAGTCATCTAAACTCGAGTTTAGATGACTTCAATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022111.2-4150s21c1
Sequence:CCGGTAGCACTGAAAGTTGGAATTGCTCGAGCAATTCCAACTTTCAGTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175554
VALIDATED
CLSPN MISSION shRNA Bacterial Glycerol Stock
claspin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175554.3-4522s1c1
Sequence:CCGGGCAGACCAGTAGAATTTAATACTCGAGTATTAAATTCTACTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175554.3-3027s1c1
Sequence:CCGGCAGCTTGTTTCAAAGGAGAATCTCGAGATTCTCCTTTGAAACAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175554.3-861s1c1
Sequence:CCGGGACGGAAATGAGTTATCCAAACTCGAGTTTGGATAACTCATTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175554.3-4007s1c1
Sequence:CCGGGCGAAGCATCTTCAGATACTTCTCGAGAAGTATCTGAAGATGCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175554.3-4707s1c1
Sequence:CCGGCCGTCCTTTATTGAGAGACATCTCGAGATGTCTCTCAATAAAGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175554.3-2204s1c1
Sequence:CCGGGTTTAAGGACAGCTCTTCTAACTCGAGTTAGAAGAGCTGTCCTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175554.3-1100s1c1
Sequence:CCGGCCATTACAAGGAAACCGTAAACTCGAGTTTACGGTTTCCTTGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175554.3-119s1c1
Sequence:CCGGCCTGGAAGTCAACGATCTAAACTCGAGTTTAGATCGTTGACTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175554
VALIDATED
CLSPN MISSION shRNA shRNA Plasmid DNA
claspin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175554.3-4522s1c1
Sequence:CCGGGCAGACCAGTAGAATTTAATACTCGAGTATTAAATTCTACTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175554.3-3027s1c1
Sequence:CCGGCAGCTTGTTTCAAAGGAGAATCTCGAGATTCTCCTTTGAAACAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175554.3-861s1c1
Sequence:CCGGGACGGAAATGAGTTATCCAAACTCGAGTTTGGATAACTCATTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175554.3-4007s1c1
Sequence:CCGGGCGAAGCATCTTCAGATACTTCTCGAGAAGTATCTGAAGATGCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175554.3-4707s1c1
Sequence:CCGGCCGTCCTTTATTGAGAGACATCTCGAGATGTCTCTCAATAAAGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175554.3-2204s1c1
Sequence:CCGGGTTTAAGGACAGCTCTTCTAACTCGAGTTAGAAGAGCTGTCCTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175554.3-1100s1c1
Sequence:CCGGCCATTACAAGGAAACCGTAAACTCGAGTTTACGGTTTCCTTGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175554.3-119s1c1
Sequence:CCGGCCTGGAAGTCAACGATCTAAACTCGAGTTTAGATCGTTGACTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175554
VALIDATED
CLSPN MISSION shRNA Lentiviral Transduction Particles
claspin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175554.3-4522s1c1
Sequence:CCGGGCAGACCAGTAGAATTTAATACTCGAGTATTAAATTCTACTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175554.3-3027s1c1
Sequence:CCGGCAGCTTGTTTCAAAGGAGAATCTCGAGATTCTCCTTTGAAACAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175554.3-861s1c1
Sequence:CCGGGACGGAAATGAGTTATCCAAACTCGAGTTTGGATAACTCATTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175554.3-4007s1c1
Sequence:CCGGGCGAAGCATCTTCAGATACTTCTCGAGAAGTATCTGAAGATGCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175554.3-4707s1c1
Sequence:CCGGCCGTCCTTTATTGAGAGACATCTCGAGATGTCTCTCAATAAAGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175554.3-2204s1c1
Sequence:CCGGGTTTAAGGACAGCTCTTCTAACTCGAGTTAGAAGAGCTGTCCTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175554.3-1100s1c1
Sequence:CCGGCCATTACAAGGAAACCGTAAACTCGAGTTTACGGTTTCCTTGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175554.3-119s1c1
Sequence:CCGGCCTGGAAGTCAACGATCTAAACTCGAGTTTAGATCGTTGACTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks