EMAIL THIS PAGE TO A FRIEND

CLSTN1

calsyntenin 1

101 Gene Product Result for
Synonyms: ALC-ALPHA CDHR12 CSTN1 PIK3CD XB31alpha alcalpha1 alcalpha2
UniProtKB ID: O94985, A8K183, Q5SR52, Q5UE58, Q71MN0, Q8N4K9
Gene ID:
Mouse(65945) calsyntenin 1
Rat(313717) calsyntenin 1
sheep(101113351) calsyntenin 1
Zebrafish(777737) calsyntenin 1
dog(479600) calsyntenin 1
cow(514447) calsyntenin 1
Horse(100057452) calsyntenin 1
domestic cat(101098804) calsyntenin 1
chicken(395372) calsyntenin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014944 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023051 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023051 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023051 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009566 Rosetta Predictions human pricing
NM_014944 Rosetta Predictions human pricing
XM_001075647 Rosetta Predictions rat pricing
XM_243040 Rosetta Predictions rat pricing
NM_023051 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043450 predicted 2399
2 SASI_Hs01_00043452 predicted 1394
3 SASI_Hs01_00043453 predicted 1663
4 SASI_Hs01_00043454 predicted 1834
5 SASI_Hs01_00043456 predicted 2906
6 SASI_Hs01_00043457 predicted 2360
7 SASI_Hs02_00305635 predicted 3138
8 SASI_Hs02_00305636 predicted 3244
9 SASI_Hs01_00043458 predicted 3158
10 SASI_Hs01_00043459 predicted 3789
11 SASI_Hs01_00043451 predicted 1963
12 SASI_Hs01_00043455 predicted 1441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201237 predicted 2371
2 SASI_Hs01_00201239 predicted 1368
3 SASI_Hs01_00201240 predicted 1639
4 SASI_Hs01_00201241 predicted 1812
5 SASI_Hs01_00201243 predicted 2871
6 SASI_Hs01_00201244 predicted 2336
7 SASI_Hs02_00346617 predicted 3117
8 SASI_Hs02_00346618 predicted 3205
9 SASI_Hs01_00201245 predicted 3127
10 SASI_Hs01_00201246 predicted 3761
11 SASI_Hs01_00201238 predicted 1939
12 SASI_Hs01_00201242 predicted 1409
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350536 predicted 1046
2 SASI_Rn02_00350537 predicted 2754
3 SASI_Rn02_00350538 predicted 1585
4 SASI_Rn02_00350539 predicted 2779
5 SASI_Rn02_00350540 predicted 1613
6 SASI_Rn02_00350541 predicted 1907
7 SASI_Rn02_00350542 predicted 970
8 SASI_Rn02_00350543 predicted 2015
9 SASI_Rn02_00350544 predicted 2155
10 SASI_Rn02_00350545 predicted 2260
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_243040 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391719 predicted 1058
2 SASI_Rn02_00391720 predicted 2757
3 SASI_Rn02_00391721 predicted 1588
4 SASI_Rn02_00391722 predicted 2782
5 SASI_Rn02_00391723 predicted 1620
6 SASI_Rn02_00391724 predicted 2799
7 SASI_Rn02_00391725 predicted 2869
8 SASI_Rn02_00391726 predicted 973
9 SASI_Rn02_00391727 predicted 2160
10 SASI_Rn02_00391728 predicted 1590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105413 predicted 278
2 SASI_Mm01_00105414 predicted 674
3 SASI_Mm01_00105415 predicted 1164
4 SASI_Mm01_00105416 predicted 1451
5 SASI_Mm01_00105417 predicted 385
6 SASI_Mm01_00105418 predicted 1246
7 SASI_Mm01_00105419 predicted 1847
8 SASI_Mm01_00105420 predicted 1428
9 SASI_Mm01_00105421 predicted 1185
10 SASI_Mm01_00105422 predicted 528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014944
VALIDATED
CLSTN1 MISSION shRNA Bacterial Glycerol Stock
calsyntenin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014944.3-2598s21c1
Sequence:CCGGCACCAGCACAATCAAGTGTTTCTCGAGAAACACTTGATTGTGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014944.3-971s21c1
Sequence:CCGGCAGGTGAGATTTGTGGATTTACTCGAGTAAATCCACAAATCTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014944.3-1320s21c1
Sequence:CCGGCCAGATTTGCAGCTACGAAATCTCGAGATTTCGTAGCTGCAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014944.3-1365s21c1
Sequence:CCGGTGTTGACAAAGATGGTTATATCTCGAGATATAACCATCTTTGTCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014944.3-3748s21c1
Sequence:CCGGCCACGATGTACAAAGTCATTTCTCGAGAAATGACTTTGTACATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014944.2-971s1c1
Sequence:CCGGCAGGTGAGATTTGTGGATTTACTCGAGTAAATCCACAAATCTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014944.2-1396s1c1
Sequence:CCGGGAGAAATTAAACTACGGGAAACTCGAGTTTCCCGTAGTTTAATTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014944.2-1320s1c1
Sequence:CCGGCCAGATTTGCAGCTACGAAATCTCGAGATTTCGTAGCTGCAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014944.2-2598s1c1
Sequence:CCGGCACCAGCACAATCAAGTGTTTCTCGAGAAACACTTGATTGTGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014944
VALIDATED
CLSTN1 MISSION shRNA shRNA Plasmid DNA
calsyntenin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014944.3-2598s21c1
Sequence:CCGGCACCAGCACAATCAAGTGTTTCTCGAGAAACACTTGATTGTGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014944.3-971s21c1
Sequence:CCGGCAGGTGAGATTTGTGGATTTACTCGAGTAAATCCACAAATCTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014944.3-1320s21c1
Sequence:CCGGCCAGATTTGCAGCTACGAAATCTCGAGATTTCGTAGCTGCAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014944.3-1365s21c1
Sequence:CCGGTGTTGACAAAGATGGTTATATCTCGAGATATAACCATCTTTGTCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014944.3-3748s21c1
Sequence:CCGGCCACGATGTACAAAGTCATTTCTCGAGAAATGACTTTGTACATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014944.2-971s1c1
Sequence:CCGGCAGGTGAGATTTGTGGATTTACTCGAGTAAATCCACAAATCTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014944.2-1396s1c1
Sequence:CCGGGAGAAATTAAACTACGGGAAACTCGAGTTTCCCGTAGTTTAATTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014944.2-1320s1c1
Sequence:CCGGCCAGATTTGCAGCTACGAAATCTCGAGATTTCGTAGCTGCAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014944.2-2598s1c1
Sequence:CCGGCACCAGCACAATCAAGTGTTTCTCGAGAAACACTTGATTGTGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014944
VALIDATED
CLSTN1 MISSION shRNA Lentiviral Transduction Particles
calsyntenin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014944.3-2598s21c1
Sequence:CCGGCACCAGCACAATCAAGTGTTTCTCGAGAAACACTTGATTGTGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014944.3-971s21c1
Sequence:CCGGCAGGTGAGATTTGTGGATTTACTCGAGTAAATCCACAAATCTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014944.3-1320s21c1
Sequence:CCGGCCAGATTTGCAGCTACGAAATCTCGAGATTTCGTAGCTGCAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014944.3-1365s21c1
Sequence:CCGGTGTTGACAAAGATGGTTATATCTCGAGATATAACCATCTTTGTCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014944.3-3748s21c1
Sequence:CCGGCCACGATGTACAAAGTCATTTCTCGAGAAATGACTTTGTACATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014944.2-971s1c1
Sequence:CCGGCAGGTGAGATTTGTGGATTTACTCGAGTAAATCCACAAATCTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014944.2-1396s1c1
Sequence:CCGGGAGAAATTAAACTACGGGAAACTCGAGTTTCCCGTAGTTTAATTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014944.2-1320s1c1
Sequence:CCGGCCAGATTTGCAGCTACGAAATCTCGAGATTTCGTAGCTGCAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014944.2-2598s1c1
Sequence:CCGGCACCAGCACAATCAAGTGTTTCTCGAGAAACACTTGATTGTGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023051
VALIDATED
CLSTN1 MISSION shRNA Bacterial Glycerol Stock
calsyntenin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023051.1-3138s1c1
Sequence:CCGGCCGCCCATCACCATTGCAGTTCTCGAGAACTGCAATGGTGATGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023051.1-1287s1c1
Sequence:CCGGCCGACACCATTATTCGCTCTACTCGAGTAGAGCGAATAATGGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023051.1-2418s1c1
Sequence:CCGGGCTCATTTGCTCAGAACTAAACTCGAGTTTAGTTCTGAGCAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023051.1-680s1c1
Sequence:CCGGCTGTGGACAAAGACGGTTATACTCGAGTATAACCGTCTTTGTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023051.1-798s1c1
Sequence:CCGGCCTAGTGAAGATAAGCGTCAACTCGAGTTGACGCTTATCTTCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023051
VALIDATED
CLSTN1 MISSION shRNA shRNA Plasmid DNA
calsyntenin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023051.1-3138s1c1
Sequence:CCGGCCGCCCATCACCATTGCAGTTCTCGAGAACTGCAATGGTGATGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023051.1-1287s1c1
Sequence:CCGGCCGACACCATTATTCGCTCTACTCGAGTAGAGCGAATAATGGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023051.1-2418s1c1
Sequence:CCGGGCTCATTTGCTCAGAACTAAACTCGAGTTTAGTTCTGAGCAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023051.1-680s1c1
Sequence:CCGGCTGTGGACAAAGACGGTTATACTCGAGTATAACCGTCTTTGTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023051.1-798s1c1
Sequence:CCGGCCTAGTGAAGATAAGCGTCAACTCGAGTTGACGCTTATCTTCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023051
VALIDATED
CLSTN1 MISSION shRNA Lentiviral Transduction Particles
calsyntenin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023051.1-3138s1c1
Sequence:CCGGCCGCCCATCACCATTGCAGTTCTCGAGAACTGCAATGGTGATGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023051.1-1287s1c1
Sequence:CCGGCCGACACCATTATTCGCTCTACTCGAGTAGAGCGAATAATGGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023051.1-2418s1c1
Sequence:CCGGGCTCATTTGCTCAGAACTAAACTCGAGTTTAGTTCTGAGCAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023051.1-680s1c1
Sequence:CCGGCTGTGGACAAAGACGGTTATACTCGAGTATAACCGTCTTTGTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023051.1-798s1c1
Sequence:CCGGCCTAGTGAAGATAAGCGTCAACTCGAGTTGACGCTTATCTTCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks