EMAIL THIS PAGE TO A FRIEND

CLSTN2

calsyntenin 2

102 Gene Product Result for
Synonyms: ALC-GAMMA CDHR13 CS2 CSTN2 alcagamma
Gene ID:
Mouse(64085) calsyntenin 2
Rat(171394) calsyntenin 2
Zebrafish(100125749) calsyntenin 2
cow(530999) calsyntenin 2
Horse(100063735) calsyntenin 2
domestic cat(101090458) calsyntenin 2
dog(477093) calsyntenin 2
chicken(424819) calsyntenin 2
sheep(101108443) calsyntenin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022131 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022131 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022131 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022319 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022319 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022319 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042661 MISSION® esiRNA esiRNA human CLSTN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022131 Rosetta Predictions human pricing
NM_134377 Rosetta Predictions rat pricing
XM_579631 Rosetta Predictions rat pricing
NM_022319 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173066 predicted 1119
2 SASI_Hs01_00173068 predicted 1414
3 SASI_Hs01_00173069 predicted 2391
4 SASI_Hs02_00355531 predicted 1656
5 SASI_Hs01_00173070 predicted 2634
6 SASI_Hs02_00355532 predicted 2310
7 SASI_Hs01_00173071 predicted 2345
8 SASI_Hs02_00355533 predicted 2080
9 SASI_Hs02_00355534 predicted 2325
10 SASI_Hs01_00173072 predicted 428
11 SASI_Hs01_00173067 predicted 1539
12 SASI_Hs01_00173073 predicted 643
13 SASI_Hs01_00173074 predicted 1358
14 SASI_Hs01_00173075 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134377 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086158 predicted 1120
2 SASI_Rn01_00086159 predicted 2332
3 SASI_Rn01_00086160 predicted 1434
4 SASI_Rn01_00086161 predicted 2574
5 SASI_Rn01_00086162 predicted 1407
6 SASI_Rn01_00086163 predicted 375
7 SASI_Rn02_00267941 predicted 2353
8 SASI_Rn01_00086165 predicted 684
9 SASI_Rn01_00086166 predicted 1196
10 SASI_Rn02_00267942 predicted 2194
11 SASI_Rn01_00086164 predicted 1361
12 SASI_Rn01_00086167 predicted 2062
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00162176 predicted 1203
2 SASI_Rn01_00162177 predicted 1179
3 SASI_Rn01_00162178 predicted 1121
4 SASI_Rn01_00162179 predicted 1113
5 SASI_Rn01_00162180 predicted 1232
6 SASI_Rn01_00162181 predicted 1142
7 SASI_Rn01_00162182 predicted 1229
8 SASI_Rn01_00162183 predicted 1121
9 SASI_Rn01_00162184 predicted 1129
10 SASI_Rn01_00162185 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326550 predicted 1660
2 SASI_Mm01_00195249 predicted 1816
3 SASI_Mm01_00195250 predicted 2760
4 SASI_Mm01_00195251 predicted 1598
5 SASI_Mm01_00195252 predicted 1388
6 SASI_Mm01_00195253 predicted 1305
7 SASI_Mm01_00195254 predicted 2244
8 SASI_Mm01_00195255 predicted 1548
9 SASI_Mm01_00195256 predicted 3185
10 SASI_Mm01_00195257 predicted 321
11 SASI_Mm01_00195258 predicted 1877
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022131
CLSTN2 MISSION shRNA Bacterial Glycerol Stock
calsyntenin 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022131.1-1808s1c1
Sequence:CCGGCGCCTCAAAGTATCCTCCAAACTCGAGTTTGGAGGATACTTTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022131.1-1345s1c1
Sequence:CCGGGCTGGATCAGATTTGTGACAACTCGAGTTGTCACAAATCTGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022131.1-442s1c1
Sequence:CCGGCGTGGTCCATATACAGGTGAACTCGAGTTCACCTGTATATGGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022131.1-106s1c1
Sequence:CCGGCCTCGCGGCTAAAGTCAATAACTCGAGTTATTGACTTTAGCCGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022131.1-2338s1c1
Sequence:CCGGGCGCTACACTAGCAATGAGTTCTCGAGAACTCATTGCTAGTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022131.2-2819s21c1
Sequence:CCGGGACGATTCTGCGCTGACTATCCTCGAGGATAGTCAGCGCAGAATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022131.2-1896s21c1
Sequence:CCGGTGATGGAAGGTGACGACATTGCTCGAGCAATGTCGTCACCTTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022131
CLSTN2 MISSION shRNA shRNA Plasmid DNA
calsyntenin 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022131.1-1808s1c1
Sequence:CCGGCGCCTCAAAGTATCCTCCAAACTCGAGTTTGGAGGATACTTTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022131.1-1345s1c1
Sequence:CCGGGCTGGATCAGATTTGTGACAACTCGAGTTGTCACAAATCTGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022131.1-442s1c1
Sequence:CCGGCGTGGTCCATATACAGGTGAACTCGAGTTCACCTGTATATGGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022131.1-106s1c1
Sequence:CCGGCCTCGCGGCTAAAGTCAATAACTCGAGTTATTGACTTTAGCCGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022131.1-2338s1c1
Sequence:CCGGGCGCTACACTAGCAATGAGTTCTCGAGAACTCATTGCTAGTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022131.2-2819s21c1
Sequence:CCGGGACGATTCTGCGCTGACTATCCTCGAGGATAGTCAGCGCAGAATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022131.2-1896s21c1
Sequence:CCGGTGATGGAAGGTGACGACATTGCTCGAGCAATGTCGTCACCTTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022131
CLSTN2 MISSION shRNA Lentiviral Transduction Particles
calsyntenin 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022131.1-1808s1c1
Sequence:CCGGCGCCTCAAAGTATCCTCCAAACTCGAGTTTGGAGGATACTTTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022131.1-1345s1c1
Sequence:CCGGGCTGGATCAGATTTGTGACAACTCGAGTTGTCACAAATCTGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022131.1-442s1c1
Sequence:CCGGCGTGGTCCATATACAGGTGAACTCGAGTTCACCTGTATATGGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022131.1-106s1c1
Sequence:CCGGCCTCGCGGCTAAAGTCAATAACTCGAGTTATTGACTTTAGCCGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022131.1-2338s1c1
Sequence:CCGGGCGCTACACTAGCAATGAGTTCTCGAGAACTCATTGCTAGTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022131.2-2819s21c1
Sequence:CCGGGACGATTCTGCGCTGACTATCCTCGAGGATAGTCAGCGCAGAATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022131.2-1896s21c1
Sequence:CCGGTGATGGAAGGTGACGACATTGCTCGAGCAATGTCGTCACCTTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022319
CLSTN2 MISSION shRNA Bacterial Glycerol Stock
calsyntenin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022319.2-3926s1c1
Sequence:CCGGCGCATTATGTTGCCGGTCAATCTCGAGATTGACCGGCAACATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022319.2-1956s1c1
Sequence:CCGGCTATATCAACTCCCGGCAATTCTCGAGAATTGCCGGGAGTTGATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022319.2-2857s1c1
Sequence:CCGGGTCAACCCTATGGAGAAACATCTCGAGATGTTTCTCCATAGGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022319.2-1944s1c1
Sequence:CCGGCCAGAAAGTCTCCTATATCAACTCGAGTTGATATAGGAGACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022319.2-345s1c1
Sequence:CCGGCGGAGTCATAACTGAGAACAACTCGAGTTGTTCTCAGTTATGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022319
CLSTN2 MISSION shRNA shRNA Plasmid DNA
calsyntenin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022319.2-3926s1c1
Sequence:CCGGCGCATTATGTTGCCGGTCAATCTCGAGATTGACCGGCAACATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022319.2-1956s1c1
Sequence:CCGGCTATATCAACTCCCGGCAATTCTCGAGAATTGCCGGGAGTTGATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022319.2-2857s1c1
Sequence:CCGGGTCAACCCTATGGAGAAACATCTCGAGATGTTTCTCCATAGGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022319.2-1944s1c1
Sequence:CCGGCCAGAAAGTCTCCTATATCAACTCGAGTTGATATAGGAGACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022319.2-345s1c1
Sequence:CCGGCGGAGTCATAACTGAGAACAACTCGAGTTGTTCTCAGTTATGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022319
CLSTN2 MISSION shRNA Lentiviral Transduction Particles
calsyntenin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022319.2-3926s1c1
Sequence:CCGGCGCATTATGTTGCCGGTCAATCTCGAGATTGACCGGCAACATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022319.2-1956s1c1
Sequence:CCGGCTATATCAACTCCCGGCAATTCTCGAGAATTGCCGGGAGTTGATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022319.2-2857s1c1
Sequence:CCGGGTCAACCCTATGGAGAAACATCTCGAGATGTTTCTCCATAGGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022319.2-1944s1c1
Sequence:CCGGCCAGAAAGTCTCCTATATCAACTCGAGTTGATATAGGAGACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022319.2-345s1c1
Sequence:CCGGCGGAGTCATAACTGAGAACAACTCGAGTTGTTCTCAGTTATGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks