EMAIL THIS PAGE TO A FRIEND

CLSTN3

calsyntenin 3

72 Gene Product Result for
Synonyms: CDHR14 CSTN3 alcbeta
UniProtKB ID: Q9BQT9, D3DUT6, O94831, Q2T9J5, Q5UE57
Gene ID:
Mouse(232370) calsyntenin 3
Rat(171393) calsyntenin 3
Zebrafish(555627) calsyntenin 3
cow(509969) calsyntenin 3
domestic cat(101089620) calsyntenin 3
dog(486711) calsyntenin 3
chicken(418297) calsyntenin 3
sheep(101106761) calsyntenin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014718 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014718 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014718 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014718 Rosetta Predictions human pricing
NM_134376 Rosetta Predictions rat pricing
NM_153508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168192 predicted 2556
2 SASI_Hs02_00346146 predicted 1454
3 SASI_Hs01_00168193 predicted 2254
4 SASI_Hs01_00168194 predicted 1963
5 SASI_Hs01_00168197 predicted 1565
6 SASI_Hs01_00168198 predicted 1033
7 SASI_Hs01_00168199 predicted 924
8 SASI_Hs01_00168200 predicted 911
9 SASI_Hs01_00168201 predicted 1655
10 SASI_Hs02_00346147 predicted 502
11 SASI_Hs01_00168195 predicted 863
12 SASI_Hs01_00168196 predicted 2635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134376 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039223 predicted 605
2 SASI_Rn02_00267939 predicted 825
3 SASI_Rn01_00039224 predicted 768
4 SASI_Rn01_00039225 predicted 2424
5 SASI_Rn01_00039228 predicted 524
6 SASI_Rn02_00267940 predicted 956
7 SASI_Rn01_00039229 predicted 1257
8 SASI_Rn01_00039230 predicted 449
9 SASI_Rn01_00039231 predicted 493
10 SASI_Rn01_00039232 predicted 1328
11 SASI_Rn01_00039226 predicted 2503
12 SASI_Rn01_00039227 predicted 1832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025162 predicted 705
2 SASI_Mm01_00025163 predicted 596
3 SASI_Mm01_00025164 predicted 2525
4 SASI_Mm01_00025165 predicted 2601
5 SASI_Mm01_00025166 predicted 1926
6 SASI_Mm01_00025167 predicted 629
7 SASI_Mm01_00025168 predicted 1612
8 SASI_Mm01_00025169 predicted 1560
9 SASI_Mm01_00025170 predicted 368
10 SASI_Mm02_00343254 predicted 2666
11 SASI_Mm01_00025171 predicted 1437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014718
VALIDATED
CLSTN3 MISSION shRNA Bacterial Glycerol Stock
calsyntenin 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014718.3-1932s21c1
Sequence:CCGGGGGCTGGACTATAGGGATTTCCTCGAGGAAATCCCTATAGTCCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014718.3-2210s21c1
Sequence:CCGGGCTGAGTGGCACTGCTCATTTCTCGAGAAATGAGCAGTGCCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014718.3-907s21c1
Sequence:CCGGGTGAGAGGCTCTATAAGTTTACTCGAGTAAACTTATAGAGCCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014718.3-682s21c1
Sequence:CCGGTCAACGATGTGAACGAGTTTGCTCGAGCAAACTCGTTCACATCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014718.3-2362s21c1
Sequence:CCGGCACGCATGTCGGATGAGATTGCTCGAGCAATCTCATCCGACATGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014718.3-3603s21c1
Sequence:CCGGCATCGTCCCTGCTTCTCTTATCTCGAGATAAGAGAAGCAGGGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014718.3-2553s21c1
Sequence:CCGGATCCTGAGGCAGGCTCGTTATCTCGAGATAACGAGCCTGCCTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_014718.3-3001s21c1
Sequence:CCGGCCATGGAGTCCTACCAGAATCCTCGAGGATTCTGGTAGGACTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014718.2-407s1c1
Sequence:CCGGCCTACTGAATCCACCACTCTTCTCGAGAAGAGTGGTGGATTCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014718.2-1296s1c1
Sequence:CCGGAGCCTGATCTACTGGTTCAATCTCGAGATTGAACCAGTAGATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014718.2-2612s1c1
Sequence:CCGGGCTTTCCTGCTCGGAAATGAACTCGAGTTCATTTCCGAGCAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014718.2-1058s1c1
Sequence:CCGGCTTGGCTTTGTTCCCTGGTATCTCGAGATACCAGGGAACAAAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_014718.2-2621s1c1
Sequence:CCGGCTCGGAAATGAATGGCCGTTACTCGAGTAACGGCCATTCATTTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014718
VALIDATED
CLSTN3 MISSION shRNA shRNA Plasmid DNA
calsyntenin 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014718.3-1932s21c1
Sequence:CCGGGGGCTGGACTATAGGGATTTCCTCGAGGAAATCCCTATAGTCCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014718.3-2210s21c1
Sequence:CCGGGCTGAGTGGCACTGCTCATTTCTCGAGAAATGAGCAGTGCCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014718.3-907s21c1
Sequence:CCGGGTGAGAGGCTCTATAAGTTTACTCGAGTAAACTTATAGAGCCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014718.3-682s21c1
Sequence:CCGGTCAACGATGTGAACGAGTTTGCTCGAGCAAACTCGTTCACATCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014718.3-2362s21c1
Sequence:CCGGCACGCATGTCGGATGAGATTGCTCGAGCAATCTCATCCGACATGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014718.3-3603s21c1
Sequence:CCGGCATCGTCCCTGCTTCTCTTATCTCGAGATAAGAGAAGCAGGGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014718.3-2553s21c1
Sequence:CCGGATCCTGAGGCAGGCTCGTTATCTCGAGATAACGAGCCTGCCTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_014718.3-3001s21c1
Sequence:CCGGCCATGGAGTCCTACCAGAATCCTCGAGGATTCTGGTAGGACTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014718.2-407s1c1
Sequence:CCGGCCTACTGAATCCACCACTCTTCTCGAGAAGAGTGGTGGATTCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014718.2-1296s1c1
Sequence:CCGGAGCCTGATCTACTGGTTCAATCTCGAGATTGAACCAGTAGATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014718.2-2612s1c1
Sequence:CCGGGCTTTCCTGCTCGGAAATGAACTCGAGTTCATTTCCGAGCAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014718.2-1058s1c1
Sequence:CCGGCTTGGCTTTGTTCCCTGGTATCTCGAGATACCAGGGAACAAAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_014718.2-2621s1c1
Sequence:CCGGCTCGGAAATGAATGGCCGTTACTCGAGTAACGGCCATTCATTTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014718
VALIDATED
CLSTN3 MISSION shRNA Lentiviral Transduction Particles
calsyntenin 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014718.3-1932s21c1
Sequence:CCGGGGGCTGGACTATAGGGATTTCCTCGAGGAAATCCCTATAGTCCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014718.3-2210s21c1
Sequence:CCGGGCTGAGTGGCACTGCTCATTTCTCGAGAAATGAGCAGTGCCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014718.3-907s21c1
Sequence:CCGGGTGAGAGGCTCTATAAGTTTACTCGAGTAAACTTATAGAGCCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014718.3-682s21c1
Sequence:CCGGTCAACGATGTGAACGAGTTTGCTCGAGCAAACTCGTTCACATCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014718.3-2362s21c1
Sequence:CCGGCACGCATGTCGGATGAGATTGCTCGAGCAATCTCATCCGACATGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014718.3-3603s21c1
Sequence:CCGGCATCGTCCCTGCTTCTCTTATCTCGAGATAAGAGAAGCAGGGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014718.3-2553s21c1
Sequence:CCGGATCCTGAGGCAGGCTCGTTATCTCGAGATAACGAGCCTGCCTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_014718.3-3001s21c1
Sequence:CCGGCCATGGAGTCCTACCAGAATCCTCGAGGATTCTGGTAGGACTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014718.2-407s1c1
Sequence:CCGGCCTACTGAATCCACCACTCTTCTCGAGAAGAGTGGTGGATTCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014718.2-1296s1c1
Sequence:CCGGAGCCTGATCTACTGGTTCAATCTCGAGATTGAACCAGTAGATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014718.2-2612s1c1
Sequence:CCGGGCTTTCCTGCTCGGAAATGAACTCGAGTTCATTTCCGAGCAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014718.2-1058s1c1
Sequence:CCGGCTTGGCTTTGTTCCCTGGTATCTCGAGATACCAGGGAACAAAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_014718.2-2621s1c1
Sequence:CCGGCTCGGAAATGAATGGCCGTTACTCGAGTAACGGCCATTCATTTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153508
VALIDATED
CLSTN3 MISSION shRNA Bacterial Glycerol Stock
calsyntenin 3
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153508.3-1343s21c1
Sequence:CCGGATGGCTTCAGCGACCACTTTACTCGAGTAAAGTGGTCGCTGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153508.3-2812s21c1
Sequence:CCGGTTTCTGGTGCTTATGGTTATCCTCGAGGATAACCATAAGCACCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153508.3-1790s21c1
Sequence:CCGGTGCTGATCCACCACTACTTTCCTCGAGGAAAGTAGTGGTGGATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153508.3-2935s21c1
Sequence:CCGGGACTCTGCTCTCACCATTATTCTCGAGAATAATGGTGAGAGCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153508.3-2324s21c1
Sequence:CCGGCACGCATGTCAGATGAGATTGCTCGAGCAATCTCATCTGACATGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153508.3-2076s21c1
Sequence:CCGGCACCGCTGTCAAGTGCTTTAGCTCGAGCTAAAGCACTTGACAGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153508.3-713s21c1
Sequence:CCGGAGCTGTATGATCGGATCTTACCTCGAGGTAAGATCCGATCATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153508.2-3677s1c1
Sequence:CCGGCCAAGGTCTTACTGTCTCTATCTCGAGATAGAGACAGTAAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153508.2-2566s1c1
Sequence:CCGGCCAGGAAATTCCGGCTTTCTTCTCGAGAAGAAAGCCGGAATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153508.2-387s1c1
Sequence:CCGGCCACTCTTTGCCTTGGATAAACTCGAGTTTATCCAAGGCAAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153508.2-2555s1c1
Sequence:CCGGTGCCCTTTATGCCAGGAAATTCTCGAGAATTTCCTGGCATAAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153508.2-1799s1c1
Sequence:CCGGCCACCACTACTTTCATGGCTACTCGAGTAGCCATGAAAGTAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153508
VALIDATED
CLSTN3 MISSION shRNA shRNA Plasmid DNA
calsyntenin 3
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153508.3-1343s21c1
Sequence:CCGGATGGCTTCAGCGACCACTTTACTCGAGTAAAGTGGTCGCTGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153508.3-2812s21c1
Sequence:CCGGTTTCTGGTGCTTATGGTTATCCTCGAGGATAACCATAAGCACCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153508.3-1790s21c1
Sequence:CCGGTGCTGATCCACCACTACTTTCCTCGAGGAAAGTAGTGGTGGATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153508.3-2935s21c1
Sequence:CCGGGACTCTGCTCTCACCATTATTCTCGAGAATAATGGTGAGAGCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153508.3-2324s21c1
Sequence:CCGGCACGCATGTCAGATGAGATTGCTCGAGCAATCTCATCTGACATGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153508.3-2076s21c1
Sequence:CCGGCACCGCTGTCAAGTGCTTTAGCTCGAGCTAAAGCACTTGACAGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153508.3-713s21c1
Sequence:CCGGAGCTGTATGATCGGATCTTACCTCGAGGTAAGATCCGATCATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153508.2-3677s1c1
Sequence:CCGGCCAAGGTCTTACTGTCTCTATCTCGAGATAGAGACAGTAAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153508.2-2566s1c1
Sequence:CCGGCCAGGAAATTCCGGCTTTCTTCTCGAGAAGAAAGCCGGAATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153508.2-387s1c1
Sequence:CCGGCCACTCTTTGCCTTGGATAAACTCGAGTTTATCCAAGGCAAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153508.2-2555s1c1
Sequence:CCGGTGCCCTTTATGCCAGGAAATTCTCGAGAATTTCCTGGCATAAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153508.2-1799s1c1
Sequence:CCGGCCACCACTACTTTCATGGCTACTCGAGTAGCCATGAAAGTAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153508
VALIDATED
CLSTN3 MISSION shRNA Lentiviral Transduction Particles
calsyntenin 3
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153508.3-1343s21c1
Sequence:CCGGATGGCTTCAGCGACCACTTTACTCGAGTAAAGTGGTCGCTGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153508.3-2812s21c1
Sequence:CCGGTTTCTGGTGCTTATGGTTATCCTCGAGGATAACCATAAGCACCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153508.3-1790s21c1
Sequence:CCGGTGCTGATCCACCACTACTTTCCTCGAGGAAAGTAGTGGTGGATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153508.3-2935s21c1
Sequence:CCGGGACTCTGCTCTCACCATTATTCTCGAGAATAATGGTGAGAGCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153508.3-2324s21c1
Sequence:CCGGCACGCATGTCAGATGAGATTGCTCGAGCAATCTCATCTGACATGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153508.3-2076s21c1
Sequence:CCGGCACCGCTGTCAAGTGCTTTAGCTCGAGCTAAAGCACTTGACAGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153508.3-713s21c1
Sequence:CCGGAGCTGTATGATCGGATCTTACCTCGAGGTAAGATCCGATCATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153508.2-3677s1c1
Sequence:CCGGCCAAGGTCTTACTGTCTCTATCTCGAGATAGAGACAGTAAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153508.2-2566s1c1
Sequence:CCGGCCAGGAAATTCCGGCTTTCTTCTCGAGAAGAAAGCCGGAATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153508.2-387s1c1
Sequence:CCGGCCACTCTTTGCCTTGGATAAACTCGAGTTTATCCAAGGCAAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153508.2-2555s1c1
Sequence:CCGGTGCCCTTTATGCCAGGAAATTCTCGAGAATTTCCTGGCATAAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153508.2-1799s1c1
Sequence:CCGGCCACCACTACTTTCATGGCTACTCGAGTAGCCATGAAAGTAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks