EMAIL THIS PAGE TO A FRIEND

CLTA

clathrin, light chain A

145 Gene Product Result for
Synonyms: LCA
UniProtKB ID: P09496, A8K4W3, B4DIN1, F5H6N3, Q2XPN5, Q53XZ1
Gene ID:
Human(1211) Summary: Clathrin is a large, soluble protein composed of heavy and light chains. It functions as the main structural component of the lattice-type cytoplasmic face of coated pits and vesicles which entrap specific macromolecules during receptor-mediated endocytosis. This gene encodes one of two clathrin light chain proteins which are believed to function as regulatory elements. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 8 and 12. [provided by RefSeq, May 2010]
Mouse(12757) clathrin, light polypeptide (Lca)
Rat(83800) clathrin, light chain A
Zebrafish(406318) clathrin, light chain (Lca)
cow(281078) clathrin, light chain A
Horse(100055375) clathrin, light chain A
domestic cat(101097521) clathrin, light chain A
dog(474765) clathrin, light chain A
chicken(427284) clathrin, light chain A
sheep(101106572) clathrin, light chain A
domestic guinea pig(100734541) clathrin, light chain A
naked mole-rat(101707717) clathrin, light chain A
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001833 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016760 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016760 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016760 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001076677 Rosetta Predictions human pricing
NM_001833 Rosetta Predictions human pricing
NM_007096 Rosetta Predictions human pricing
NM_031974 Rosetta Predictions rat pricing
NM_001080384 Rosetta Predictions mouse pricing
NM_001080385 Rosetta Predictions mouse pricing
NM_001080386 Rosetta Predictions mouse pricing
NM_016760 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311954 predicted 439
2 SASI_Hs02_00311955 predicted 482
3 SASI_Hs02_00311956 predicted 884
4 SASI_Hs02_00311957 predicted 487
5 SASI_Hs02_00311958 predicted 651
6 SASI_Hs02_00311959 predicted 261
7 SASI_Hs02_00311960 predicted 530
8 SASI_Hs02_00311961 predicted 929
9 SASI_Hs02_00311962 predicted 635
10 SASI_Hs02_00311963 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332639 predicted 869
2 SASI_Hs01_00157082 predicted 431
3 SASI_Hs01_00157084 predicted 569
4 SASI_Hs01_00157085 predicted 483
5 SASI_Hs01_00157086 predicted 832
6 SASI_Hs02_00332640 predicted 430
7 SASI_Hs02_00332641 predicted 830
8 SASI_Hs01_00157087 predicted 632
9 SASI_Hs01_00157088 predicted 878
10 SASI_Hs01_00157089 predicted 284
11 SASI_Hs01_00157081 predicted 577
12 SASI_Hs01_00157083 predicted 807
13 SASI_Hs01_00157090 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122508 predicted 438
2 SASI_Hs01_00122509 predicted 686
3 SASI_Hs01_00122511 predicted 684
4 SASI_Hs01_00122512 predicted 480
5 SASI_Hs01_00122513 predicted 920
6 SASI_Hs01_00122514 predicted 486
7 SASI_Hs01_00122515 predicted 646
8 SASI_Hs02_00342929 predicted 260
9 SASI_Hs01_00122516 predicted 536
10 SASI_Hs01_00122517 predicted 973
11 SASI_Hs01_00122510 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081175 predicted 877
2 SASI_Rn01_00081176 predicted 632
3 SASI_Rn01_00081179 predicted 638
4 SASI_Rn01_00081180 predicted 619
5 SASI_Rn01_00081181 predicted 601
6 SASI_Rn01_00081182 predicted 633
7 SASI_Rn01_00081183 predicted 329
8 SASI_Rn01_00081184 predicted 332
9 SASI_Rn02_00265365 predicted 561
10 SASI_Rn02_00265366 predicted 890
11 SASI_Rn01_00081177 predicted 238
12 SASI_Rn01_00081178 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293393 predicted 238
2 SASI_Mm02_00293394 predicted 371
3 SASI_Mm02_00293395 predicted 356
4 SASI_Mm02_00293396 predicted 267
5 SASI_Mm02_00293397 predicted 211
6 SASI_Mm02_00293398 predicted 849
7 SASI_Mm02_00293399 predicted 402
8 SASI_Mm02_00293400 predicted 349
9 SASI_Mm02_00293401 predicted 349
10 SASI_Mm02_00293402 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293403 predicted 234
2 SASI_Mm02_00293404 predicted 375
3 SASI_Mm02_00293405 predicted 362
4 SASI_Mm02_00293406 predicted 264
5 SASI_Mm02_00293407 predicted 211
6 SASI_Mm02_00293408 predicted 944
7 SASI_Mm02_00293409 predicted 395
8 SASI_Mm02_00293410 predicted 341
9 SASI_Mm02_00293411 predicted 345
10 SASI_Mm02_00293412 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293413 predicted 410
2 SASI_Mm02_00293414 predicted 818
3 SASI_Mm02_00293415 predicted 532
4 SASI_Mm02_00293416 predicted 633
5 SASI_Mm02_00293417 predicted 450
6 SASI_Mm02_00293418 predicted 263
7 SASI_Mm02_00293419 predicted 594
8 SASI_Mm02_00293420 predicted 843
9 SASI_Mm02_00293421 predicted 518
10 SASI_Mm02_00293422 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016760 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323505 predicted 234
2 SASI_Mm02_00323506 predicted 375
3 SASI_Mm02_00323507 predicted 357
4 SASI_Mm01_00085896 predicted 264
5 SASI_Mm02_00323508 predicted 209
6 SASI_Mm01_00085900 predicted 900
7 SASI_Mm02_00323509 predicted 404
8 SASI_Mm02_00323510 predicted 345
9 SASI_Mm02_00323511 predicted 350
10 SASI_Mm02_00323512 predicted 375
11 SASI_Mm01_00085891 predicted 379
12 SASI_Mm01_00085892 predicted 591
13 SASI_Mm01_00085893 predicted 491
14 SASI_Mm01_00085894 predicted 839
15 SASI_Mm01_00085895 predicted 418
16 SASI_Mm01_00085897 predicted 648
17 SASI_Mm01_00085898 predicted 656
18 SASI_Mm01_00085899 predicted 614
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001833
VALIDATED
CLTA MISSION shRNA Bacterial Glycerol Stock
clathrin, light chain A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001833.1-578s1c1
Sequence:CCGGGAAGCCTTTGTAAATGACATTCTCGAGAATGTCATTTACAAAGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001833.1-302s1c1
Sequence:CCGGGCTGTTGATGGAGTAATGAATCTCGAGATTCATTACTCCATCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001833.1-326s1c1
Sequence:CCGGGAATACTACCAGGAAAGTAATCTCGAGATTACTTTCCTGGTAGTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001833.1-455s1c1
Sequence:CCGGGATGCCAATTCTCGGAAGCAACTCGAGTTGCTTCCGAGAATTGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001833.1-399s1c1
Sequence:CCGGAGCCTGAAAGTATCCGTAAATCTCGAGATTTACGGATACTTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001833.2-839s21c1
Sequence:GTACCGGACTACATCTGCAATATCTTAACTCGAGTTAAGATATTGCAGATGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001833.2-406s21c1
Sequence:CCGGGAATACTACCAGGAAAGTAATCTCGAGATTACTTTCCTGGTAGTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001833.2-658s21c1
Sequence:CCGGGAAGCCTTTGTAAATGACATTCTCGAGAATGTCATTTACAAAGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001833.2-479s21c1
Sequence:CCGGAGCCTGAAAGTATCCGTAAATCTCGAGATTTACGGATACTTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001833.2-382s21c1
Sequence:CCGGGCTGTTGATGGAGTAATGAATCTCGAGATTCATTACTCCATCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001833.2-524s21c1
Sequence:GTACCGGTGGAAGCCCTTGATGCCAATTCTCGAGAATTGGCATCAAGGGCTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001833.2-435s21c1
Sequence:GTACCGGAGACAGTTATGCAGCTATTTCCTCGAGGAAATAGCTGCATAACTGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001833.2-740s21c1
Sequence:GTACCGGAGTCTAGCAAGCAGGCCAAAGCTCGAGCTTTGGCCTGCTTGCTAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001833
VALIDATED
CLTA MISSION shRNA shRNA Plasmid DNA
clathrin, light chain A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001833.1-578s1c1
Sequence:CCGGGAAGCCTTTGTAAATGACATTCTCGAGAATGTCATTTACAAAGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001833.1-302s1c1
Sequence:CCGGGCTGTTGATGGAGTAATGAATCTCGAGATTCATTACTCCATCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001833.1-326s1c1
Sequence:CCGGGAATACTACCAGGAAAGTAATCTCGAGATTACTTTCCTGGTAGTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001833.1-455s1c1
Sequence:CCGGGATGCCAATTCTCGGAAGCAACTCGAGTTGCTTCCGAGAATTGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001833.1-399s1c1
Sequence:CCGGAGCCTGAAAGTATCCGTAAATCTCGAGATTTACGGATACTTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001833.2-839s21c1
Sequence:GTACCGGACTACATCTGCAATATCTTAACTCGAGTTAAGATATTGCAGATGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001833.2-406s21c1
Sequence:CCGGGAATACTACCAGGAAAGTAATCTCGAGATTACTTTCCTGGTAGTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001833.2-658s21c1
Sequence:CCGGGAAGCCTTTGTAAATGACATTCTCGAGAATGTCATTTACAAAGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001833.2-479s21c1
Sequence:CCGGAGCCTGAAAGTATCCGTAAATCTCGAGATTTACGGATACTTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001833.2-382s21c1
Sequence:CCGGGCTGTTGATGGAGTAATGAATCTCGAGATTCATTACTCCATCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001833.2-524s21c1
Sequence:GTACCGGTGGAAGCCCTTGATGCCAATTCTCGAGAATTGGCATCAAGGGCTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001833.2-435s21c1
Sequence:GTACCGGAGACAGTTATGCAGCTATTTCCTCGAGGAAATAGCTGCATAACTGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001833.2-740s21c1
Sequence:GTACCGGAGTCTAGCAAGCAGGCCAAAGCTCGAGCTTTGGCCTGCTTGCTAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001833
VALIDATED
CLTA MISSION shRNA Lentiviral Transduction Particles
clathrin, light chain A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001833.1-578s1c1
Sequence:CCGGGAAGCCTTTGTAAATGACATTCTCGAGAATGTCATTTACAAAGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001833.1-302s1c1
Sequence:CCGGGCTGTTGATGGAGTAATGAATCTCGAGATTCATTACTCCATCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001833.1-326s1c1
Sequence:CCGGGAATACTACCAGGAAAGTAATCTCGAGATTACTTTCCTGGTAGTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001833.1-455s1c1
Sequence:CCGGGATGCCAATTCTCGGAAGCAACTCGAGTTGCTTCCGAGAATTGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001833.1-399s1c1
Sequence:CCGGAGCCTGAAAGTATCCGTAAATCTCGAGATTTACGGATACTTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001833.2-839s21c1
Sequence:GTACCGGACTACATCTGCAATATCTTAACTCGAGTTAAGATATTGCAGATGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001833.2-406s21c1
Sequence:CCGGGAATACTACCAGGAAAGTAATCTCGAGATTACTTTCCTGGTAGTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001833.2-658s21c1
Sequence:CCGGGAAGCCTTTGTAAATGACATTCTCGAGAATGTCATTTACAAAGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001833.2-479s21c1
Sequence:CCGGAGCCTGAAAGTATCCGTAAATCTCGAGATTTACGGATACTTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001833.2-382s21c1
Sequence:CCGGGCTGTTGATGGAGTAATGAATCTCGAGATTCATTACTCCATCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001833.2-524s21c1
Sequence:GTACCGGTGGAAGCCCTTGATGCCAATTCTCGAGAATTGGCATCAAGGGCTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001833.2-435s21c1
Sequence:GTACCGGAGACAGTTATGCAGCTATTTCCTCGAGGAAATAGCTGCATAACTGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001833.2-740s21c1
Sequence:GTACCGGAGTCTAGCAAGCAGGCCAAAGCTCGAGCTTTGGCCTGCTTGCTAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016760
VALIDATED
CLTA MISSION shRNA Bacterial Glycerol Stock
clathrin, light chain A
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016760.1-825s1c1
Sequence:CCGGCCTGTTGAAACACTACGTCTACTCGAGTAGACGTAGTGTTTCAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016760.1-217s1c1
Sequence:CCGGGCGCACGAAGAGAGTGAGATTCTCGAGAATCTCACTCTCTTCGTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016760.1-655s1c1
Sequence:CCGGGAAGCCTTTGTAAACGACATTCTCGAGAATGTCGTTTACAAAGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016760.1-333s1c1
Sequence:CCGGCGGAGTGATGAATGGTGAATACTCGAGTATTCACCATTCATCACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016760.1-420s1c1
Sequence:CCGGAGAGCCTGAAAGTATCCGTAACTCGAGTTACGGATACTTTCAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016760.2-640s21c1
Sequence:CCGGCAGACGAAGCTTTCTACAAACCTCGAGGTTTGTAGAAAGCTTCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016760.2-880s21c1
Sequence:CCGGACTACGTCTACAATATCTTAACTCGAGTTAAGATATTGTAGACGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016760.2-666s21c1
Sequence:CCGGTTCGCTGACCTGATTGGTTATCTCGAGATAACCAATCAGGTCAGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016760.2-699s21c1
Sequence:CCGGGAAGCCTTTGTAAACGACATTCTCGAGAATGTCGTTTACAAAGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016760.2-377s21c1
Sequence:CCGGCGGAGTGATGAATGGTGAATACTCGAGTATTCACCATTCATCACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016760.2-985s21c1
Sequence:GTACCGGTTGTTTGTGATTGCATGTTTCCTCGAGGAAACATGCAATCACAAACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016760.2-465s21c1
Sequence:GTACCGGGAGCCTGAAAGTATCCGTAAGCTCGAGCTTACGGATACTTTCAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016760
VALIDATED
CLTA MISSION shRNA shRNA Plasmid DNA
clathrin, light chain A
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016760.1-825s1c1
Sequence:CCGGCCTGTTGAAACACTACGTCTACTCGAGTAGACGTAGTGTTTCAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016760.1-217s1c1
Sequence:CCGGGCGCACGAAGAGAGTGAGATTCTCGAGAATCTCACTCTCTTCGTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016760.1-655s1c1
Sequence:CCGGGAAGCCTTTGTAAACGACATTCTCGAGAATGTCGTTTACAAAGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016760.1-333s1c1
Sequence:CCGGCGGAGTGATGAATGGTGAATACTCGAGTATTCACCATTCATCACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016760.1-420s1c1
Sequence:CCGGAGAGCCTGAAAGTATCCGTAACTCGAGTTACGGATACTTTCAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016760.2-640s21c1
Sequence:CCGGCAGACGAAGCTTTCTACAAACCTCGAGGTTTGTAGAAAGCTTCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016760.2-880s21c1
Sequence:CCGGACTACGTCTACAATATCTTAACTCGAGTTAAGATATTGTAGACGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016760.2-666s21c1
Sequence:CCGGTTCGCTGACCTGATTGGTTATCTCGAGATAACCAATCAGGTCAGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016760.2-699s21c1
Sequence:CCGGGAAGCCTTTGTAAACGACATTCTCGAGAATGTCGTTTACAAAGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016760.2-377s21c1
Sequence:CCGGCGGAGTGATGAATGGTGAATACTCGAGTATTCACCATTCATCACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016760.2-985s21c1
Sequence:GTACCGGTTGTTTGTGATTGCATGTTTCCTCGAGGAAACATGCAATCACAAACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016760.2-465s21c1
Sequence:GTACCGGGAGCCTGAAAGTATCCGTAAGCTCGAGCTTACGGATACTTTCAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016760
VALIDATED
CLTA MISSION shRNA Lentiviral Transduction Particles
clathrin, light chain A
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016760.1-825s1c1
Sequence:CCGGCCTGTTGAAACACTACGTCTACTCGAGTAGACGTAGTGTTTCAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016760.1-217s1c1
Sequence:CCGGGCGCACGAAGAGAGTGAGATTCTCGAGAATCTCACTCTCTTCGTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016760.1-655s1c1
Sequence:CCGGGAAGCCTTTGTAAACGACATTCTCGAGAATGTCGTTTACAAAGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016760.1-333s1c1
Sequence:CCGGCGGAGTGATGAATGGTGAATACTCGAGTATTCACCATTCATCACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016760.1-420s1c1
Sequence:CCGGAGAGCCTGAAAGTATCCGTAACTCGAGTTACGGATACTTTCAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016760.2-640s21c1
Sequence:CCGGCAGACGAAGCTTTCTACAAACCTCGAGGTTTGTAGAAAGCTTCGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016760.2-880s21c1
Sequence:CCGGACTACGTCTACAATATCTTAACTCGAGTTAAGATATTGTAGACGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016760.2-666s21c1
Sequence:CCGGTTCGCTGACCTGATTGGTTATCTCGAGATAACCAATCAGGTCAGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016760.2-699s21c1
Sequence:CCGGGAAGCCTTTGTAAACGACATTCTCGAGAATGTCGTTTACAAAGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016760.2-377s21c1
Sequence:CCGGCGGAGTGATGAATGGTGAATACTCGAGTATTCACCATTCATCACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016760.2-985s21c1
Sequence:GTACCGGTTGTTTGTGATTGCATGTTTCCTCGAGGAAACATGCAATCACAAACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016760.2-465s21c1
Sequence:GTACCGGGAGCCTGAAAGTATCCGTAAGCTCGAGCTTACGGATACTTTCAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)