EMAIL THIS PAGE TO A FRIEND

CLTB

clathrin, light chain B

67 Gene Product Result for
Synonyms: LCB
UniProtKB ID: P09497, Q53Y37, Q6FHW1
Gene ID:
Human(1212) Summary: Clathrin is a large, soluble protein composed of heavy and light chains. It functions as the main structural component of the lattice-type cytoplasmic face of coated pits and vesicles which entrap specific macromolecules during receptor-mediated endocytosis. This gene encodes one of two clathrin light chain proteins which are believed to function as regulatory elements. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(74325) clathrin, light polypeptide (Lcb)
Rat(116561) clathrin, light chain B
naked mole-rat(101713269) clathrin, light chain B
domestic guinea pig(100731665) clathrin, light chain B
sheep(101117328) clathrin, light chain B
chicken(416226) clathrin, light chain B
cow(281698) clathrin, light chain B
domestic cat(101088646) clathrin, light chain B
dog(489104) clathrin, light chain B
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028870 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028870 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028870 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001834 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001834 Rosetta Predictions human pricing
NM_007097 Rosetta Predictions human pricing
NM_053835 Rosetta Predictions rat pricing
NM_028870 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236211 predicted 270
2 SASI_Hs01_00236213 predicted 268
3 SASI_Hs01_00236214 predicted 274
4 SASI_Hs01_00236215 predicted 408
5 SASI_Hs01_00236216 predicted 409
6 SASI_Hs01_00236217 predicted 397
7 SASI_Hs01_00236218 predicted 415
8 SASI_Hs01_00236219 predicted 406
9 SASI_Hs01_00236212 predicted 382
10 SASI_Hs01_00236220 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217586 predicted 266
2 SASI_Hs01_00217588 predicted 266
3 SASI_Hs01_00217589 predicted 268
4 SASI_Hs01_00217590 predicted 414
5 SASI_Hs01_00217591 predicted 403
6 SASI_Hs01_00217592 predicted 394
7 SASI_Hs01_00217593 predicted 413
8 SASI_Hs01_00217594 predicted 406
9 SASI_Hs01_00217587 predicted 383
10 SASI_Hs01_00217595 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059236 predicted 438
2 SASI_Rn01_00059237 predicted 452
3 SASI_Rn01_00059238 predicted 326
4 SASI_Rn01_00059239 predicted 610
5 SASI_Rn01_00059240 predicted 283
6 SASI_Rn01_00059242 predicted 438
7 SASI_Rn01_00059243 predicted 497
8 SASI_Rn01_00059244 predicted 385
9 SASI_Rn02_00266680 predicted 308
10 SASI_Rn02_00266681 predicted 379
11 SASI_Rn01_00059241 predicted 759
12 SASI_Rn01_00059245 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182380 predicted 411
2 SASI_Mm01_00182381 predicted 891
3 SASI_Mm01_00182382 predicted 262
4 SASI_Mm01_00182384 predicted 210
5 SASI_Mm01_00182385 predicted 1064
6 SASI_Mm01_00182386 predicted 843
7 SASI_Mm01_00182387 predicted 1130
8 SASI_Mm02_00334546 predicted 1117
9 SASI_Mm01_00182388 predicted 974
10 SASI_Mm02_00334547 predicted 837
11 SASI_Mm01_00182383 predicted 424
12 SASI_Mm01_00182389 predicted 567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028870
VALIDATED
CLTB MISSION shRNA Bacterial Glycerol Stock
clathrin, light chain B
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-208s21c1
Sequence:GTACCGGACATGAGTACTACAGTCAATGCTCGAGCATTGACTGTAGTACTCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-434s21c1
Sequence:GTACCGGCCAAAGTGAACAGGTTGAGAACTCGAGTTCTCAACCTGTTCACTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-109s21c1
Sequence:CCGGAGATTGCTGGCATCGAGAATGCTCGAGCATTCTCGATGCCAGCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028870.3-848s21c1
Sequence:CCGGTCCTGTCAGCCCACTCAATTGCTCGAGCAATTGAGTGGGCTGACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-571s21c1
Sequence:CCGGGCAAGCAGTGTAAAGATGTGTCTCGAGACACATCTTTACACTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-545s21c1
Sequence:CCGGGCTGTGTGACTTCAATCCCAACTCGAGTTGGGATTGAAGTCACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-231s21c1
Sequence:GTACCGGGATGTGTTTCAGGAGGCTAACCTCGAGGTTAGCCTCCTGAAACACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-464s21c1
Sequence:GTACCGGCAACAACAGGGCATCGGAAGACTCGAGTCTTCCGATGCCCTGTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028870.1-1097s1c1
Sequence:CCGGCCCTCCAAGAAGAAAGGCAAACTCGAGTTTGCCTTTCTTCTTGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028870.1-572s1c1
Sequence:CCGGGCAAGCAGTGTAAAGATGTGTCTCGAGACACATCTTTACACTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028870.1-119s1c1
Sequence:CCGGGCATCGAGAATGACCCGGGTTCTCGAGAACCCGGGTCATTCTCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028870.1-546s1c1
Sequence:CCGGGCTGTGTGACTTCAATCCCAACTCGAGTTGGGATTGAAGTCACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028870
VALIDATED
CLTB MISSION shRNA shRNA Plasmid DNA
clathrin, light chain B
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-208s21c1
Sequence:GTACCGGACATGAGTACTACAGTCAATGCTCGAGCATTGACTGTAGTACTCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-434s21c1
Sequence:GTACCGGCCAAAGTGAACAGGTTGAGAACTCGAGTTCTCAACCTGTTCACTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-109s21c1
Sequence:CCGGAGATTGCTGGCATCGAGAATGCTCGAGCATTCTCGATGCCAGCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028870.3-848s21c1
Sequence:CCGGTCCTGTCAGCCCACTCAATTGCTCGAGCAATTGAGTGGGCTGACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-571s21c1
Sequence:CCGGGCAAGCAGTGTAAAGATGTGTCTCGAGACACATCTTTACACTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-545s21c1
Sequence:CCGGGCTGTGTGACTTCAATCCCAACTCGAGTTGGGATTGAAGTCACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-231s21c1
Sequence:GTACCGGGATGTGTTTCAGGAGGCTAACCTCGAGGTTAGCCTCCTGAAACACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-464s21c1
Sequence:GTACCGGCAACAACAGGGCATCGGAAGACTCGAGTCTTCCGATGCCCTGTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028870.1-1097s1c1
Sequence:CCGGCCCTCCAAGAAGAAAGGCAAACTCGAGTTTGCCTTTCTTCTTGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028870.1-572s1c1
Sequence:CCGGGCAAGCAGTGTAAAGATGTGTCTCGAGACACATCTTTACACTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028870.1-119s1c1
Sequence:CCGGGCATCGAGAATGACCCGGGTTCTCGAGAACCCGGGTCATTCTCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028870.1-546s1c1
Sequence:CCGGGCTGTGTGACTTCAATCCCAACTCGAGTTGGGATTGAAGTCACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028870
VALIDATED
CLTB MISSION shRNA Lentiviral Transduction Particles
clathrin, light chain B
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-208s21c1
Sequence:GTACCGGACATGAGTACTACAGTCAATGCTCGAGCATTGACTGTAGTACTCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-434s21c1
Sequence:GTACCGGCCAAAGTGAACAGGTTGAGAACTCGAGTTCTCAACCTGTTCACTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-109s21c1
Sequence:CCGGAGATTGCTGGCATCGAGAATGCTCGAGCATTCTCGATGCCAGCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028870.3-848s21c1
Sequence:CCGGTCCTGTCAGCCCACTCAATTGCTCGAGCAATTGAGTGGGCTGACAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-571s21c1
Sequence:CCGGGCAAGCAGTGTAAAGATGTGTCTCGAGACACATCTTTACACTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-545s21c1
Sequence:CCGGGCTGTGTGACTTCAATCCCAACTCGAGTTGGGATTGAAGTCACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-231s21c1
Sequence:GTACCGGGATGTGTTTCAGGAGGCTAACCTCGAGGTTAGCCTCCTGAAACACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028870.3-464s21c1
Sequence:GTACCGGCAACAACAGGGCATCGGAAGACTCGAGTCTTCCGATGCCCTGTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028870.1-1097s1c1
Sequence:CCGGCCCTCCAAGAAGAAAGGCAAACTCGAGTTTGCCTTTCTTCTTGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028870.1-572s1c1
Sequence:CCGGGCAAGCAGTGTAAAGATGTGTCTCGAGACACATCTTTACACTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028870.1-119s1c1
Sequence:CCGGGCATCGAGAATGACCCGGGTTCTCGAGAACCCGGGTCATTCTCGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028870.1-546s1c1
Sequence:CCGGGCTGTGTGACTTCAATCCCAACTCGAGTTGGGATTGAAGTCACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001834
VALIDATED
CLTB MISSION shRNA Bacterial Glycerol Stock
clathrin, light chain B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001834.2-521s21c1
Sequence:GTACCGGGAGCTGGATGCTGCATCTAAGCTCGAGCTTAGATGCAGCATCCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001834.2-648s21c1
Sequence:CCGGAGGAGGCTTTCGTGAAGGAATCTCGAGATTCCTTCACGAAAGCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001834.2-734s21c1
Sequence:CCGGAGCAGCAAGCAGTGCAAAGATCTCGAGATCTTTGCACTGCTTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001834.2-385s21c1
Sequence:CCGGCACAGTCAATGGAGATGTGTTCTCGAGAACACATCTCCATTGACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001834.2-899s21c1
Sequence:CCGGAGCTGCTACCCACAGCCTATTCTCGAGAATAGGCTGTGGGTAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001834.2-270s21c1
Sequence:CCGGAGAGCGAGATTGCAGGCATAGCTCGAGCTATGCCTGCAATCTCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001834.2-530s1c1
Sequence:CCGGGCTGCATCTAAGGTCACGGAACTCGAGTTCCGTGACCTTAGATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001834.2-648s1c1
Sequence:CCGGAGGAGGCTTTCGTGAAGGAATCTCGAGATTCCTTCACGAAAGCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001834.2-425s1c1
Sequence:CCGGGCTGATGGCTACGCAGCCATTCTCGAGAATGGCTGCGTAGCCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001834.2-613s1c1
Sequence:CCGGAGTAGAGAAGAACAAGATCAACTCGAGTTGATCTTGTTCTTCTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001834.2-734s1c1
Sequence:CCGGAGCAGCAAGCAGTGCAAAGATCTCGAGATCTTTGCACTGCTTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001834
VALIDATED
CLTB MISSION shRNA shRNA Plasmid DNA
clathrin, light chain B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001834.2-521s21c1
Sequence:GTACCGGGAGCTGGATGCTGCATCTAAGCTCGAGCTTAGATGCAGCATCCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001834.2-648s21c1
Sequence:CCGGAGGAGGCTTTCGTGAAGGAATCTCGAGATTCCTTCACGAAAGCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001834.2-734s21c1
Sequence:CCGGAGCAGCAAGCAGTGCAAAGATCTCGAGATCTTTGCACTGCTTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001834.2-385s21c1
Sequence:CCGGCACAGTCAATGGAGATGTGTTCTCGAGAACACATCTCCATTGACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001834.2-899s21c1
Sequence:CCGGAGCTGCTACCCACAGCCTATTCTCGAGAATAGGCTGTGGGTAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001834.2-270s21c1
Sequence:CCGGAGAGCGAGATTGCAGGCATAGCTCGAGCTATGCCTGCAATCTCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001834.2-530s1c1
Sequence:CCGGGCTGCATCTAAGGTCACGGAACTCGAGTTCCGTGACCTTAGATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001834.2-648s1c1
Sequence:CCGGAGGAGGCTTTCGTGAAGGAATCTCGAGATTCCTTCACGAAAGCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001834.2-425s1c1
Sequence:CCGGGCTGATGGCTACGCAGCCATTCTCGAGAATGGCTGCGTAGCCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001834.2-613s1c1
Sequence:CCGGAGTAGAGAAGAACAAGATCAACTCGAGTTGATCTTGTTCTTCTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001834.2-734s1c1
Sequence:CCGGAGCAGCAAGCAGTGCAAAGATCTCGAGATCTTTGCACTGCTTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001834
VALIDATED
CLTB MISSION shRNA Lentiviral Transduction Particles
clathrin, light chain B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001834.2-521s21c1
Sequence:GTACCGGGAGCTGGATGCTGCATCTAAGCTCGAGCTTAGATGCAGCATCCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001834.2-648s21c1
Sequence:CCGGAGGAGGCTTTCGTGAAGGAATCTCGAGATTCCTTCACGAAAGCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001834.2-734s21c1
Sequence:CCGGAGCAGCAAGCAGTGCAAAGATCTCGAGATCTTTGCACTGCTTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001834.2-385s21c1
Sequence:CCGGCACAGTCAATGGAGATGTGTTCTCGAGAACACATCTCCATTGACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001834.2-899s21c1
Sequence:CCGGAGCTGCTACCCACAGCCTATTCTCGAGAATAGGCTGTGGGTAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001834.2-270s21c1
Sequence:CCGGAGAGCGAGATTGCAGGCATAGCTCGAGCTATGCCTGCAATCTCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001834.2-530s1c1
Sequence:CCGGGCTGCATCTAAGGTCACGGAACTCGAGTTCCGTGACCTTAGATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001834.2-648s1c1
Sequence:CCGGAGGAGGCTTTCGTGAAGGAATCTCGAGATTCCTTCACGAAAGCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001834.2-425s1c1
Sequence:CCGGGCTGATGGCTACGCAGCCATTCTCGAGAATGGCTGCGTAGCCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001834.2-613s1c1
Sequence:CCGGAGTAGAGAAGAACAAGATCAACTCGAGTTGATCTTGTTCTTCTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001834.2-734s1c1
Sequence:CCGGAGCAGCAAGCAGTGCAAAGATCTCGAGATCTTTGCACTGCTTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)