EMAIL THIS PAGE TO A FRIEND

CLTC

clathrin, heavy chain (Hc)

133 Gene Product Result for
Synonyms: CHC CHC17 CLH-17 CLTCL2 Hc
UniProtKB ID: Q00610, D3DU00, Q6N0A0, Q86TF2
Gene ID:
Human(1213) Summary: Clathrin is a major protein component of the cytoplasmic face of intracellular organelles, called coated vesicles and coated pits. These specialized organelles are involved in the intracellular trafficking of receptors and endocytosis of a variety of macromolecules. The basic subunit of the clathrin coat is composed of three heavy chains and three light chains. [provided by RefSeq, Jul 2008]
Mouse(67300) clathrin, heavy polypeptide (Hc)
Rat(54241) clathrin, heavy chain (Hc)
Zebrafish(100330183) clathrin, heavy chain (Hc)
dog(480578) clathrin, heavy chain (Hc)
cow(281080) clathrin, heavy chain (Hc)
Horse(100057364) clathrin, heavy chain (Hc)
domestic cat(101081341) clathrin, heavy chain (Hc)
chicken(395272) clathrin, heavy chain (Hc)
sheep(101107114) clathrin, heavy chain (Hc)
Domestic Rabbit(100338178) clathrin, heavy chain (Hc)
domestic guinea pig(100728704) clathrin, heavy chain (Hc)
naked mole-rat(101720552) clathrin, heavy chain (Hc)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003908 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003908 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003908 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004859 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004859 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004859 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004859 Rosetta Predictions human pricing
NM_019299 Rosetta Predictions rat pricing
NM_001003908 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208103 predicted 2261
2 SASI_Hs02_00338467 predicted 1033
3 SASI_Hs01_00208106 predicted 605
4 SASI_Hs01_00208107 predicted 984
5 SASI_Hs02_00338468 predicted 2392
6 SASI_Hs01_00208108 predicted 889
7 SASI_Hs01_00208109 predicted 3530
8 SASI_Hs02_00338469 predicted 2239
9 SASI_Hs02_00338470 predicted 4122
10 SASI_Hs02_00338471 predicted 614
11 SASI_Hs01_00208104 predicted 4857
12 SASI_Hs01_00208105 predicted 1286
13 SASI_Hs01_00208110 predicted 3752
14 SASI_Hs01_00208111 predicted 1116
15 SASI_Hs01_00208112 predicted 1767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019299 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041427 predicted 4439
2 SASI_Rn01_00041428 predicted 3239
3 SASI_Rn01_00041429 predicted 1733
4 SASI_Rn01_00041430 predicted 3693
5 SASI_Rn01_00041431 predicted 3311
6 SASI_Rn01_00041432 predicted 4704
7 SASI_Rn01_00041433 predicted 264
8 SASI_Rn02_00262258 predicted 3757
9 SASI_Rn01_00041434 predicted 3954
10 SASI_Rn01_00041435 predicted 1450
11 SASI_Rn01_00041436 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088441 predicted 3091
2 SASI_Mm01_00088442 predicted 3103
3 SASI_Mm01_00088443 predicted 4541
4 SASI_Mm01_00088444 predicted 372
5 SASI_Mm01_00088445 predicted 2460
6 SASI_Mm01_00088446 predicted 206
7 SASI_Mm01_00088447 predicted 3421
8 SASI_Mm01_00088448 predicted 4811
9 SASI_Mm01_00088449 predicted 3288
10 SASI_Mm01_00088450 predicted 3792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003908
VALIDATED
CLTC MISSION shRNA Bacterial Glycerol Stock
clathrin, heavy chain (Hc)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003908.1-5688s1c1
Sequence:CCGGGCCGACAAAGACAACACTAATCTCGAGATTAGTGTTGTCTTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003908.1-3357s1c1
Sequence:CCGGGCTCCAGATATTGCCAACATTCTCGAGAATGTTGGCAATATCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003908.1-2871s1c1
Sequence:CCGGCCAGAGAGATTTCTTCGTGAACTCGAGTTCACGAAGAAATCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003908.1-1482s1c1
Sequence:CCGGCTGAACAAATACGAGTCCTTACTCGAGTAAGGACTCGTATTTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003908.1-4643s1c1
Sequence:CCGGGCGAACATCAATAGATGCTTACTCGAGTAAGCATCTATTGATGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003908.1-3357s21c1
Sequence:CCGGGCTCCAGATATTGCCAACATTCTCGAGAATGTTGGCAATATCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003908.1-2871s21c1
Sequence:CCGGCCAGAGAGATTTCTTCGTGAACTCGAGTTCACGAAGAAATCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003908.1-5688s21c1
Sequence:CCGGGCCGACAAAGACAACACTAATCTCGAGATTAGTGTTGTCTTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003908.1-4643s21c1
Sequence:CCGGGCGAACATCAATAGATGCTTACTCGAGTAAGCATCTATTGATGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003908.1-3315s21c1
Sequence:GTACCGGACACGTGTTATGGAGTATATTCTCGAGAATATACTCCATAACACGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003908.1-1028s21c1
Sequence:GTACCGGGATTACCAAGTATGGTTATATCTCGAGATATAACCATACTTGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003908
VALIDATED
CLTC MISSION shRNA shRNA Plasmid DNA
clathrin, heavy chain (Hc)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003908.1-5688s1c1
Sequence:CCGGGCCGACAAAGACAACACTAATCTCGAGATTAGTGTTGTCTTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003908.1-3357s1c1
Sequence:CCGGGCTCCAGATATTGCCAACATTCTCGAGAATGTTGGCAATATCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003908.1-2871s1c1
Sequence:CCGGCCAGAGAGATTTCTTCGTGAACTCGAGTTCACGAAGAAATCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003908.1-1482s1c1
Sequence:CCGGCTGAACAAATACGAGTCCTTACTCGAGTAAGGACTCGTATTTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003908.1-4643s1c1
Sequence:CCGGGCGAACATCAATAGATGCTTACTCGAGTAAGCATCTATTGATGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003908.1-3357s21c1
Sequence:CCGGGCTCCAGATATTGCCAACATTCTCGAGAATGTTGGCAATATCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003908.1-2871s21c1
Sequence:CCGGCCAGAGAGATTTCTTCGTGAACTCGAGTTCACGAAGAAATCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003908.1-5688s21c1
Sequence:CCGGGCCGACAAAGACAACACTAATCTCGAGATTAGTGTTGTCTTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003908.1-4643s21c1
Sequence:CCGGGCGAACATCAATAGATGCTTACTCGAGTAAGCATCTATTGATGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003908.1-3315s21c1
Sequence:GTACCGGACACGTGTTATGGAGTATATTCTCGAGAATATACTCCATAACACGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003908.1-1028s21c1
Sequence:GTACCGGGATTACCAAGTATGGTTATATCTCGAGATATAACCATACTTGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003908
VALIDATED
CLTC MISSION shRNA Lentiviral Transduction Particles
clathrin, heavy chain (Hc)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003908.1-5688s1c1
Sequence:CCGGGCCGACAAAGACAACACTAATCTCGAGATTAGTGTTGTCTTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003908.1-3357s1c1
Sequence:CCGGGCTCCAGATATTGCCAACATTCTCGAGAATGTTGGCAATATCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003908.1-2871s1c1
Sequence:CCGGCCAGAGAGATTTCTTCGTGAACTCGAGTTCACGAAGAAATCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003908.1-1482s1c1
Sequence:CCGGCTGAACAAATACGAGTCCTTACTCGAGTAAGGACTCGTATTTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003908.1-4643s1c1
Sequence:CCGGGCGAACATCAATAGATGCTTACTCGAGTAAGCATCTATTGATGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003908.1-3357s21c1
Sequence:CCGGGCTCCAGATATTGCCAACATTCTCGAGAATGTTGGCAATATCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003908.1-2871s21c1
Sequence:CCGGCCAGAGAGATTTCTTCGTGAACTCGAGTTCACGAAGAAATCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003908.1-5688s21c1
Sequence:CCGGGCCGACAAAGACAACACTAATCTCGAGATTAGTGTTGTCTTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003908.1-4643s21c1
Sequence:CCGGGCGAACATCAATAGATGCTTACTCGAGTAAGCATCTATTGATGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003908.1-3315s21c1
Sequence:GTACCGGACACGTGTTATGGAGTATATTCTCGAGAATATACTCCATAACACGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003908.1-1028s21c1
Sequence:GTACCGGGATTACCAAGTATGGTTATATCTCGAGATATAACCATACTTGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004859
VALIDATED
CLTC MISSION shRNA Bacterial Glycerol Stock
clathrin, heavy chain (Hc)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004859.2-3008s1c1
Sequence:CCGGGCCAATGTGATCTGGAACTTACTCGAGTAAGTTCCAGATCACATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004859.2-4013s1c1
Sequence:CCGGCCTGTGTAGATGGGAAAGAATCTCGAGATTCTTTCCCATCTACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004859.2-5355s1c1
Sequence:CCGGCGTGTTCTTGTAACCTTTATTCTCGAGAATAAAGGTTACAAGAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004859.2-1834s1c1
Sequence:CCGGGCCCAAATGTTAGTTCAAGATCTCGAGATCTTGAACTAACATTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004859.2-590s1c1
Sequence:CCGGCGGTTGCTCTTGTTACGGATACTCGAGTATCCGTAACAAGAGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004859.3-4738s21c1
Sequence:GTACCGGACACTCGTGCAGTCAATTATTCTCGAGAATAATTGACTGCACGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004859.3-5561s21c1
Sequence:CCGGCGTGTTCTTGTAACCTTTATTCTCGAGAATAAAGGTTACAAGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004859.3-2040s21c1
Sequence:CCGGGCCCAAATGTTAGTTCAAGATCTCGAGATCTTGAACTAACATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004859.3-796s21c1
Sequence:CCGGCGGTTGCTCTTGTTACGGATACTCGAGTATCCGTAACAAGAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004859.3-3214s21c1
Sequence:CCGGGCCAATGTGATCTGGAACTTACTCGAGTAAGTTCCAGATCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004859
VALIDATED
CLTC MISSION shRNA shRNA Plasmid DNA
clathrin, heavy chain (Hc)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004859.2-3008s1c1
Sequence:CCGGGCCAATGTGATCTGGAACTTACTCGAGTAAGTTCCAGATCACATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004859.2-4013s1c1
Sequence:CCGGCCTGTGTAGATGGGAAAGAATCTCGAGATTCTTTCCCATCTACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004859.2-5355s1c1
Sequence:CCGGCGTGTTCTTGTAACCTTTATTCTCGAGAATAAAGGTTACAAGAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004859.2-1834s1c1
Sequence:CCGGGCCCAAATGTTAGTTCAAGATCTCGAGATCTTGAACTAACATTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004859.2-590s1c1
Sequence:CCGGCGGTTGCTCTTGTTACGGATACTCGAGTATCCGTAACAAGAGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004859.3-4738s21c1
Sequence:GTACCGGACACTCGTGCAGTCAATTATTCTCGAGAATAATTGACTGCACGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004859.3-5561s21c1
Sequence:CCGGCGTGTTCTTGTAACCTTTATTCTCGAGAATAAAGGTTACAAGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004859.3-2040s21c1
Sequence:CCGGGCCCAAATGTTAGTTCAAGATCTCGAGATCTTGAACTAACATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004859.3-796s21c1
Sequence:CCGGCGGTTGCTCTTGTTACGGATACTCGAGTATCCGTAACAAGAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004859.3-3214s21c1
Sequence:CCGGGCCAATGTGATCTGGAACTTACTCGAGTAAGTTCCAGATCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004859
VALIDATED
CLTC MISSION shRNA Lentiviral Transduction Particles
clathrin, heavy chain (Hc)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004859.2-3008s1c1
Sequence:CCGGGCCAATGTGATCTGGAACTTACTCGAGTAAGTTCCAGATCACATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004859.2-4013s1c1
Sequence:CCGGCCTGTGTAGATGGGAAAGAATCTCGAGATTCTTTCCCATCTACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004859.2-5355s1c1
Sequence:CCGGCGTGTTCTTGTAACCTTTATTCTCGAGAATAAAGGTTACAAGAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004859.2-1834s1c1
Sequence:CCGGGCCCAAATGTTAGTTCAAGATCTCGAGATCTTGAACTAACATTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004859.2-590s1c1
Sequence:CCGGCGGTTGCTCTTGTTACGGATACTCGAGTATCCGTAACAAGAGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004859.3-4738s21c1
Sequence:GTACCGGACACTCGTGCAGTCAATTATTCTCGAGAATAATTGACTGCACGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004859.3-5561s21c1
Sequence:CCGGCGTGTTCTTGTAACCTTTATTCTCGAGAATAAAGGTTACAAGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004859.3-2040s21c1
Sequence:CCGGGCCCAAATGTTAGTTCAAGATCTCGAGATCTTGAACTAACATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004859.3-796s21c1
Sequence:CCGGCGGTTGCTCTTGTTACGGATACTCGAGTATCCGTAACAAGAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004859.3-3214s21c1
Sequence:CCGGGCCAATGTGATCTGGAACTTACTCGAGTAAGTTCCAGATCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks