EMAIL THIS PAGE TO A FRIEND

CLTCL1

clathrin, heavy chain-like 1

29 Gene Product Result for
Synonyms: CHC22 CLH22 CLTCL CLTD
UniProtKB ID: P53675, B7Z7U5, Q14017, Q15808, Q15809
Gene ID:
Human(8218) Summary: This gene is a member of the clathrin heavy chain family and encodes a major protein of the polyhedral coat of coated pits and vesicles. Chromosomal aberrations involving this gene are associated with meningioma, DiGeorge syndrome, and velo-cardio-facial syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
chicken(416765) clathrin, heavy chain-like 1
dog(477568) clathrin, heavy chain-like 1
domestic cat(101081257) clathrin, heavy chain-like 1
naked mole-rat(101708690) clathrin, heavy chain-like 1
domestic guinea pig(100735504) clathrin, heavy chain-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA075795 Anti-CLTCL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001835 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001835 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001835 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063161 MISSION® esiRNA esiRNA human CLTCL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001835 Rosetta Predictions human pricing
NM_007098 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091625 predicted 3113
2 SASI_Hs01_00091626 predicted 989
3 SASI_Hs01_00091627 predicted 837
4 SASI_Hs01_00091628 predicted 3450
5 SASI_Hs01_00091629 predicted 3490
6 SASI_Hs01_00091630 predicted 1244
7 SASI_Hs01_00091631 predicted 845
8 SASI_Hs01_00091632 predicted 4213
9 SASI_Hs01_00091633 predicted 967
10 SASI_Hs01_00091634 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342930 predicted 226
2 SASI_Hs01_00137681 predicted 3134
3 SASI_Hs01_00137684 predicted 3477
4 SASI_Hs01_00137685 predicted 3515
5 SASI_Hs01_00137686 predicted 1269
6 SASI_Hs01_00137687 predicted 875
7 SASI_Hs01_00137689 predicted 1001
8 SASI_Hs01_00137690 predicted 497
9 SASI_Hs02_00342931 predicted 2751
10 SASI_Hs02_00342932 predicted 2629
11 SASI_Hs01_00137682 predicted 986
12 SASI_Hs01_00137683 predicted 828
13 SASI_Hs01_00137688 predicted 4215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001835
CLTCL1 MISSION shRNA Bacterial Glycerol Stock
clathrin, heavy chain-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001835.1-4932s1c1
Sequence:CCGGCCCTACCTGCAGAGTTACTAACTCGAGTTAGTAACTCTGCAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001835.1-1236s1c1
Sequence:CCGGGTCCAGAAATTCCAGAGTATACTCGAGTATACTCTGGAATTTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001835.1-831s1c1
Sequence:CCGGGCTATGCAGATTGGAGCTAAACTCGAGTTTAGCTCCAATCTGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001835.1-2408s1c1
Sequence:CCGGCCTATATTTATACCGCAACAACTCGAGTTGTTGCGGTATAAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001835.1-1234s1c1
Sequence:CCGGCGGTCCAGAAATTCCAGAGTACTCGAGTACTCTGGAATTTCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001835
CLTCL1 MISSION shRNA shRNA Plasmid DNA
clathrin, heavy chain-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001835.1-4932s1c1
Sequence:CCGGCCCTACCTGCAGAGTTACTAACTCGAGTTAGTAACTCTGCAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001835.1-1236s1c1
Sequence:CCGGGTCCAGAAATTCCAGAGTATACTCGAGTATACTCTGGAATTTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001835.1-831s1c1
Sequence:CCGGGCTATGCAGATTGGAGCTAAACTCGAGTTTAGCTCCAATCTGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001835.1-2408s1c1
Sequence:CCGGCCTATATTTATACCGCAACAACTCGAGTTGTTGCGGTATAAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001835.1-1234s1c1
Sequence:CCGGCGGTCCAGAAATTCCAGAGTACTCGAGTACTCTGGAATTTCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001835
CLTCL1 MISSION shRNA Lentiviral Transduction Particles
clathrin, heavy chain-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001835.1-4932s1c1
Sequence:CCGGCCCTACCTGCAGAGTTACTAACTCGAGTTAGTAACTCTGCAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001835.1-1236s1c1
Sequence:CCGGGTCCAGAAATTCCAGAGTATACTCGAGTATACTCTGGAATTTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001835.1-831s1c1
Sequence:CCGGGCTATGCAGATTGGAGCTAAACTCGAGTTTAGCTCCAATCTGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001835.1-2408s1c1
Sequence:CCGGCCTATATTTATACCGCAACAACTCGAGTTGTTGCGGTATAAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001835.1-1234s1c1
Sequence:CCGGCGGTCCAGAAATTCCAGAGTACTCGAGTACTCTGGAATTTCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks