EMAIL THIS PAGE TO A FRIEND

CLU

clusterin

142 Gene Product Result for
Synonyms: APO-J APOJ CLI CLU1 CLU2 KUB1 NA1/NA2 SGP-2 SGP2 SP-40 TRPM-2 TRPM2
Gene ID:
Human(1191) Summary: The protein encoded by this gene is a secreted chaperone that can under some stress conditions also be found in the cell cytosol. It has been suggested to be involved in several basic biological events such as cell death, tumor progression, and neurodegenerative disorders. Alternate splicing results in both coding and non-coding variants.[provided by RefSeq, May 2011]
Mouse(12759) clusterin
Rat(24854) clusterin
Zebrafish(393775) clusterin
cow(280750) clusterin
Horse(100034172) clusterin
dog(442971) clusterin
chicken(395722) clusterin
fruit fly(36793) clueless
sheep(101113728) clusterin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A2229 Anti-Apolipoprotein J antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB2502026 Anti-Clu antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat
ELISA, western blot pricing
SAB2502095 Anti-CLU antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA000572 Anti-CLU antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB3500199 Anti-Clusterin antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2500251 Anti-Clusterin/APOJ (AB1) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine
ELISA, western blot pricing
SAB2500252 Anti-Clusterin/APOJ (AB2) antibody produced in goat affinity isolated antibody, buffered aqueous solution rat
ELISA, immunofluorescence, western blot pricing
WH0001191M1 Monoclonal Anti-CLU antibody produced in mouse clone 1A11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403676 Monoclonal Anti-CLU, (C-terminal) antibody produced in mouse clone 2F12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013492 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013492 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013492 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203339 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001831 Rosetta Predictions human pricing
NM_203339 Rosetta Predictions human pricing
NM_053021 Rosetta Predictions rat pricing
NM_013492 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066487 predicted 416
2 SASI_Hs02_00332634 predicted 1201
3 SASI_Hs01_00066489 predicted 431
4 SASI_Hs01_00066490 predicted 414
5 SASI_Hs01_00066491 predicted 1074
6 SASI_Hs01_00066493 predicted 991
7 SASI_Hs01_00066496 predicted 1527
8 SASI_Hs02_00332635 predicted 1082
9 SASI_Hs02_00332636 predicted 738
10 SASI_Hs02_00332637 predicted 1531
11 SASI_Hs01_00066488 predicted 520
12 SASI_Hs01_00066492 predicted 1447
13 SASI_Hs01_00066494 predicted 496
14 SASI_Hs01_00066495 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046038 predicted 543
2 SASI_Hs02_00373270 predicted 1321
3 SASI_Hs01_00046040 predicted 549
4 SASI_Hs01_00046041 predicted 535
5 SASI_Hs01_00046042 predicted 1186
6 SASI_Hs01_00046044 predicted 1113
7 SASI_Hs01_00046047 predicted 1648
8 SASI_Hs02_00373271 predicted 1201
9 SASI_Hs02_00373272 predicted 853
10 SASI_Hs02_00373273 predicted 1643
11 SASI_Hs01_00046039 predicted 636
12 SASI_Hs01_00046043 predicted 1567
13 SASI_Hs01_00046045 predicted 618
14 SASI_Hs01_00046046 predicted 1570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068347 predicted 390
2 SASI_Rn01_00068348 predicted 456
3 SASI_Rn02_00265639 predicted 1205
4 SASI_Rn01_00068350 predicted 403
5 SASI_Rn01_00068351 predicted 603
6 SASI_Rn01_00068352 predicted 381
7 SASI_Rn01_00068353 predicted 555
8 SASI_Rn01_00068354 predicted 1126
9 SASI_Rn01_00068355 predicted 1012
10 SASI_Rn02_00265640 predicted 402
11 SASI_Rn01_00068346 predicted 1551
12 SASI_Rn01_00068349 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065960 predicted 660
2 SASI_Mm01_00065961 predicted 194
3 SASI_Mm01_00065963 predicted 1436
4 SASI_Mm01_00065964 predicted 1334
5 SASI_Mm02_00322131 predicted 1354
6 SASI_Mm01_00065965 predicted 354
7 SASI_Mm01_00065966 predicted 1358
8 SASI_Mm01_00065967 predicted 975
9 SASI_Mm01_00065968 predicted 803
10 SASI_Mm01_00065969 predicted 919
11 SASI_Mm01_00065962 predicted 1352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013492
VALIDATED
CLU MISSION shRNA Bacterial Glycerol Stock
clusterin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013492.1-1452s1c1
Sequence:CCGGCCTTCCTATATGTAGGAGTGTCTCGAGACACTCCTACATATAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013492.1-238s1c1
Sequence:CCGGCCAGGGAGTGAAGCACATAAACTCGAGTTTATGTGCTTCACTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013492.1-733s1c1
Sequence:CCGGGCCTCATTTCTTATATCCCAACTCGAGTTGGGATATAAGAAATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013492.1-443s1c1
Sequence:CCGGCATACCTGCATGAAGTTCTATCTCGAGATAGAACTTCATGCAGGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013492.1-442s1c1
Sequence:CCGGGCATACCTGCATGAAGTTCTACTCGAGTAGAACTTCATGCAGGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013492
VALIDATED
CLU MISSION shRNA shRNA Plasmid DNA
clusterin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013492.1-1452s1c1
Sequence:CCGGCCTTCCTATATGTAGGAGTGTCTCGAGACACTCCTACATATAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013492.1-238s1c1
Sequence:CCGGCCAGGGAGTGAAGCACATAAACTCGAGTTTATGTGCTTCACTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013492.1-733s1c1
Sequence:CCGGGCCTCATTTCTTATATCCCAACTCGAGTTGGGATATAAGAAATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013492.1-443s1c1
Sequence:CCGGCATACCTGCATGAAGTTCTATCTCGAGATAGAACTTCATGCAGGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013492.1-442s1c1
Sequence:CCGGGCATACCTGCATGAAGTTCTACTCGAGTAGAACTTCATGCAGGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013492
VALIDATED
CLU MISSION shRNA Lentiviral Transduction Particles
clusterin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013492.1-1452s1c1
Sequence:CCGGCCTTCCTATATGTAGGAGTGTCTCGAGACACTCCTACATATAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013492.1-238s1c1
Sequence:CCGGCCAGGGAGTGAAGCACATAAACTCGAGTTTATGTGCTTCACTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013492.1-733s1c1
Sequence:CCGGGCCTCATTTCTTATATCCCAACTCGAGTTGGGATATAAGAAATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013492.1-443s1c1
Sequence:CCGGCATACCTGCATGAAGTTCTATCTCGAGATAGAACTTCATGCAGGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013492.1-442s1c1
Sequence:CCGGGCATACCTGCATGAAGTTCTACTCGAGTAGAACTTCATGCAGGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203339
VALIDATED
CLU MISSION shRNA Bacterial Glycerol Stock
clusterin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203339.1-653s1c1
Sequence:CCGGCCTGAAACAGACCTGCATGAACTCGAGTTCATGCAGGTCTGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_203339.1-1337s1c1
Sequence:CCGGGCTAAAGTCCTACCAGTGGAACTCGAGTTCCACTGGTAGGACTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_203339.1-415s1c1
Sequence:CCGGAGGGAAGTAAGTACGTCAATACTCGAGTATTGACGTACTTACTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_203339.1-414s1c1
Sequence:CCGGCAGGGAAGTAAGTACGTCAATCTCGAGATTGACGTACTTACTTCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203339.1-2470s1c1
Sequence:CCGGCCGGTTTATATGATCTTCATACTCGAGTATGAAGATCATATAAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_203339.1-1384s21c1
Sequence:CCGGAGCAGCTGAACGAGCAGTTTACTCGAGTAAACTGCTCGTTCAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_203339.1-1855s21c1
Sequence:CCGGTTGCTCCTGCATGCAACTAATCTCGAGATTAGTTGCATGCAGGAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_203339.1-1337s21c1
Sequence:CCGGGCTAAAGTCCTACCAGTGGAACTCGAGTTCCACTGGTAGGACTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_203339.1-414s21c1
Sequence:CCGGCAGGGAAGTAAGTACGTCAATCTCGAGATTGACGTACTTACTTCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_203339.1-1576s21c1
Sequence:CCGGCCAGGAAGAACCCTAAATTTACTCGAGTAAATTTAGGGTTCTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203339
VALIDATED
CLU MISSION shRNA shRNA Plasmid DNA
clusterin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203339.1-653s1c1
Sequence:CCGGCCTGAAACAGACCTGCATGAACTCGAGTTCATGCAGGTCTGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_203339.1-1337s1c1
Sequence:CCGGGCTAAAGTCCTACCAGTGGAACTCGAGTTCCACTGGTAGGACTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_203339.1-415s1c1
Sequence:CCGGAGGGAAGTAAGTACGTCAATACTCGAGTATTGACGTACTTACTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_203339.1-414s1c1
Sequence:CCGGCAGGGAAGTAAGTACGTCAATCTCGAGATTGACGTACTTACTTCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203339.1-2470s1c1
Sequence:CCGGCCGGTTTATATGATCTTCATACTCGAGTATGAAGATCATATAAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_203339.1-1384s21c1
Sequence:CCGGAGCAGCTGAACGAGCAGTTTACTCGAGTAAACTGCTCGTTCAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_203339.1-1855s21c1
Sequence:CCGGTTGCTCCTGCATGCAACTAATCTCGAGATTAGTTGCATGCAGGAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_203339.1-1337s21c1
Sequence:CCGGGCTAAAGTCCTACCAGTGGAACTCGAGTTCCACTGGTAGGACTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_203339.1-414s21c1
Sequence:CCGGCAGGGAAGTAAGTACGTCAATCTCGAGATTGACGTACTTACTTCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_203339.1-1576s21c1
Sequence:CCGGCCAGGAAGAACCCTAAATTTACTCGAGTAAATTTAGGGTTCTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203339
VALIDATED
CLU MISSION shRNA Lentiviral Transduction Particles
clusterin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203339.1-653s1c1
Sequence:CCGGCCTGAAACAGACCTGCATGAACTCGAGTTCATGCAGGTCTGTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_203339.1-1337s1c1
Sequence:CCGGGCTAAAGTCCTACCAGTGGAACTCGAGTTCCACTGGTAGGACTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_203339.1-415s1c1
Sequence:CCGGAGGGAAGTAAGTACGTCAATACTCGAGTATTGACGTACTTACTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_203339.1-414s1c1
Sequence:CCGGCAGGGAAGTAAGTACGTCAATCTCGAGATTGACGTACTTACTTCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203339.1-2470s1c1
Sequence:CCGGCCGGTTTATATGATCTTCATACTCGAGTATGAAGATCATATAAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_203339.1-1384s21c1
Sequence:CCGGAGCAGCTGAACGAGCAGTTTACTCGAGTAAACTGCTCGTTCAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_203339.1-1855s21c1
Sequence:CCGGTTGCTCCTGCATGCAACTAATCTCGAGATTAGTTGCATGCAGGAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_203339.1-1337s21c1
Sequence:CCGGGCTAAAGTCCTACCAGTGGAACTCGAGTTCCACTGGTAGGACTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_203339.1-414s21c1
Sequence:CCGGCAGGGAAGTAAGTACGTCAATCTCGAGATTGACGTACTTACTTCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_203339.1-1576s21c1
Sequence:CCGGCCAGGAAGAACCCTAAATTTACTCGAGTAAATTTAGGGTTCTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)