EMAIL THIS PAGE TO A FRIEND

CLUAP1

clusterin associated protein 1

107 Gene Product Result for
Synonyms: FAP22
UniProtKB ID: Q96AJ1, O75138, Q65ZA3, Q9H8R4, Q9H8T1
Gene ID:
Human(23059) Summary: The protein encoded by this gene contains a single coiled-coil region. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Mouse(76779) clusterin associated protein 1
Rat(363544) clusterin associated protein 1
Zebrafish(406281) clusterin associated protein 1
chicken(426077) clusterin associated protein 1
domestic cat(101096693) clusterin associated protein 1
cow(617589) clusterin associated protein 1
dog(479868) clusterin associated protein 1
naked mole-rat(101708399) clusterin associated protein 1
domestic guinea pig(100715639) clusterin associated protein 1
Goat(100861055) clusterin associated protein 1
sheep(101121306) clusterin associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029738 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029738 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029738 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024793 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024793 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024793 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140011 MISSION® esiRNA esiRNA human CLUAP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015041 Rosetta Predictions human pricing
NM_024793 Rosetta Predictions human pricing
NM_001014225 Rosetta Predictions rat pricing
NM_029738 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089369 predicted 1380
2 SASI_Hs01_00089370 predicted 864
3 SASI_Hs01_00089371 predicted 1383
4 SASI_Hs01_00089372 predicted 1404
5 SASI_Hs01_00089373 predicted 1290
6 SASI_Hs01_00089375 predicted 870
7 SASI_Hs01_00089376 predicted 1285
8 SASI_Hs01_00089377 predicted 1272
9 SASI_Hs01_00089378 predicted 933
10 SASI_Hs02_00346878 predicted 1235
11 SASI_Hs01_00089374 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178137 predicted 858
2 SASI_Hs01_00178138 predicted 341
3 SASI_Hs01_00178139 predicted 863
4 SASI_Hs01_00178140 predicted 881
5 SASI_Hs01_00178141 predicted 767
6 SASI_Hs01_00178143 predicted 344
7 SASI_Hs01_00178144 predicted 758
8 SASI_Hs01_00178145 predicted 747
9 SASI_Hs01_00178146 predicted 400
10 SASI_Hs02_00357343 predicted 708
11 SASI_Hs01_00178142 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014225 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052044 predicted 783
2 SASI_Rn01_00052045 predicted 887
3 SASI_Rn01_00052046 predicted 1290
4 SASI_Rn01_00052047 predicted 1262
5 SASI_Rn01_00052048 predicted 698
6 SASI_Rn01_00052049 predicted 627
7 SASI_Rn01_00052050 predicted 1453
8 SASI_Rn01_00052051 predicted 933
9 SASI_Rn01_00052052 predicted 595
10 SASI_Rn01_00052053 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166154 predicted 377
2 SASI_Mm01_00166156 predicted 714
3 SASI_Mm01_00166157 predicted 563
4 SASI_Mm01_00166158 predicted 254
5 SASI_Mm01_00166159 predicted 483
6 SASI_Mm01_00166160 predicted 292
7 SASI_Mm01_00166161 predicted 577
8 SASI_Mm02_00335838 predicted 554
9 SASI_Mm02_00335839 predicted 1346
10 SASI_Mm01_00166162 predicted 671
11 SASI_Mm01_00166155 predicted 623
12 SASI_Mm01_00166163 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029738
VALIDATED
CLUAP1 MISSION shRNA Bacterial Glycerol Stock
clusterin associated protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029738.2-1310s21c1
Sequence:CCGGCCAGTCGAAGGATCCGTAAACCTCGAGGTTTACGGATCCTTCGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029738.2-420s1c1
Sequence:CCGGGATCACATCTGTTCTCTATAACTCGAGTTATAGAGAACAGATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029738.2-1388s21c1
Sequence:CCGGATTAAGAGCCTCAGATGTATACTCGAGTATACATCTGAGGCTCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029738.2-200s21c1
Sequence:CCGGATTTCCGCACACCCAACTTTGCTCGAGCAAAGTTGGGTGTGCGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029738.2-838s21c1
Sequence:CCGGCCGGCCTTTATGGATGAATATCTCGAGATATTCATCCATAAAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029738.2-716s21c1
Sequence:CCGGAGACTAAAGACCTGCTTAATACTCGAGTATTAAGCAGGTCTTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029738.1-280s1c1
Sequence:CCGGCCTTCTGACATTGAGACTGAACTCGAGTTCAGTCTCAATGTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029738.1-714s1c1
Sequence:CCGGGAAGACTAAAGACCTGCTTAACTCGAGTTAAGCAGGTCTTTAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029738
VALIDATED
CLUAP1 MISSION shRNA shRNA Plasmid DNA
clusterin associated protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029738.2-1310s21c1
Sequence:CCGGCCAGTCGAAGGATCCGTAAACCTCGAGGTTTACGGATCCTTCGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029738.2-420s1c1
Sequence:CCGGGATCACATCTGTTCTCTATAACTCGAGTTATAGAGAACAGATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029738.2-1388s21c1
Sequence:CCGGATTAAGAGCCTCAGATGTATACTCGAGTATACATCTGAGGCTCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029738.2-200s21c1
Sequence:CCGGATTTCCGCACACCCAACTTTGCTCGAGCAAAGTTGGGTGTGCGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029738.2-838s21c1
Sequence:CCGGCCGGCCTTTATGGATGAATATCTCGAGATATTCATCCATAAAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029738.2-716s21c1
Sequence:CCGGAGACTAAAGACCTGCTTAATACTCGAGTATTAAGCAGGTCTTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029738.1-280s1c1
Sequence:CCGGCCTTCTGACATTGAGACTGAACTCGAGTTCAGTCTCAATGTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029738.1-714s1c1
Sequence:CCGGGAAGACTAAAGACCTGCTTAACTCGAGTTAAGCAGGTCTTTAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029738
VALIDATED
CLUAP1 MISSION shRNA Lentiviral Transduction Particles
clusterin associated protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029738.2-1310s21c1
Sequence:CCGGCCAGTCGAAGGATCCGTAAACCTCGAGGTTTACGGATCCTTCGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029738.2-420s1c1
Sequence:CCGGGATCACATCTGTTCTCTATAACTCGAGTTATAGAGAACAGATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029738.2-1388s21c1
Sequence:CCGGATTAAGAGCCTCAGATGTATACTCGAGTATACATCTGAGGCTCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029738.2-200s21c1
Sequence:CCGGATTTCCGCACACCCAACTTTGCTCGAGCAAAGTTGGGTGTGCGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029738.2-838s21c1
Sequence:CCGGCCGGCCTTTATGGATGAATATCTCGAGATATTCATCCATAAAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029738.2-716s21c1
Sequence:CCGGAGACTAAAGACCTGCTTAATACTCGAGTATTAAGCAGGTCTTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029738.1-280s1c1
Sequence:CCGGCCTTCTGACATTGAGACTGAACTCGAGTTCAGTCTCAATGTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029738.1-714s1c1
Sequence:CCGGGAAGACTAAAGACCTGCTTAACTCGAGTTAAGCAGGTCTTTAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024793
VALIDATED
CLUAP1 MISSION shRNA Bacterial Glycerol Stock
clusterin associated protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_024793.1-769s21c1
Sequence:CCGGCAATCGAAGGGTCCGGAAATCCTCGAGGATTTCCGGACCCTTCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024793.1-532s21c1
Sequence:CCGGCATCCAGGAGGACGATGAATCCTCGAGGATTCATCGTCCTCCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024793.1-856s21c1
Sequence:CCGGCCCTCAGACTTGTAGGTAAATCTCGAGATTTACCTACAAGTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_024793.1-510s21c1
Sequence:CCGGGTAACGATGACTCGGACATAGCTCGAGCTATGTCCGAGTCATCGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_024793.1-713s21c1
Sequence:CCGGGATGACGAGGATGACGATTTGCTCGAGCAAATCGTCATCCTCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024793.1-311s1c1
Sequence:CCGGGAGTATGAGAAGACTGAGGAACTCGAGTTCCTCAGTCTTCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024793.1-1735s1c1
Sequence:CCGGCGCTACCTAAGTGTTTCTGTACTCGAGTACAGAAACACTTAGGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167969    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024793.1-856s1c1
Sequence:CCGGCCCTCAGACTTGTAGGTAAATCTCGAGATTTACCTACAAGTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024793
VALIDATED
CLUAP1 MISSION shRNA shRNA Plasmid DNA
clusterin associated protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_024793.1-769s21c1
Sequence:CCGGCAATCGAAGGGTCCGGAAATCCTCGAGGATTTCCGGACCCTTCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024793.1-532s21c1
Sequence:CCGGCATCCAGGAGGACGATGAATCCTCGAGGATTCATCGTCCTCCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024793.1-856s21c1
Sequence:CCGGCCCTCAGACTTGTAGGTAAATCTCGAGATTTACCTACAAGTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_024793.1-510s21c1
Sequence:CCGGGTAACGATGACTCGGACATAGCTCGAGCTATGTCCGAGTCATCGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_024793.1-713s21c1
Sequence:CCGGGATGACGAGGATGACGATTTGCTCGAGCAAATCGTCATCCTCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024793.1-311s1c1
Sequence:CCGGGAGTATGAGAAGACTGAGGAACTCGAGTTCCTCAGTCTTCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024793.1-1735s1c1
Sequence:CCGGCGCTACCTAAGTGTTTCTGTACTCGAGTACAGAAACACTTAGGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167969    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024793.1-856s1c1
Sequence:CCGGCCCTCAGACTTGTAGGTAAATCTCGAGATTTACCTACAAGTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024793
VALIDATED
CLUAP1 MISSION shRNA Lentiviral Transduction Particles
clusterin associated protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_024793.1-769s21c1
Sequence:CCGGCAATCGAAGGGTCCGGAAATCCTCGAGGATTTCCGGACCCTTCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024793.1-532s21c1
Sequence:CCGGCATCCAGGAGGACGATGAATCCTCGAGGATTCATCGTCCTCCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024793.1-856s21c1
Sequence:CCGGCCCTCAGACTTGTAGGTAAATCTCGAGATTTACCTACAAGTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_024793.1-510s21c1
Sequence:CCGGGTAACGATGACTCGGACATAGCTCGAGCTATGTCCGAGTCATCGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_024793.1-713s21c1
Sequence:CCGGGATGACGAGGATGACGATTTGCTCGAGCAAATCGTCATCCTCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024793.1-311s1c1
Sequence:CCGGGAGTATGAGAAGACTGAGGAACTCGAGTTCCTCAGTCTTCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024793.1-1735s1c1
Sequence:CCGGCGCTACCTAAGTGTTTCTGTACTCGAGTACAGAAACACTTAGGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167969    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024793.1-856s1c1
Sequence:CCGGCCCTCAGACTTGTAGGTAAATCTCGAGATTTACCTACAAGTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks