EMAIL THIS PAGE TO A FRIEND

CLUH

clustered mitochondria (cluA/CLU1) homolog

144 Gene Product Result for
Synonyms: CLU1 KIAA0664
Species: Human CLUH(23277), Mouse Cluh(74148), Rat Cluh(303300), Zebrafish cluh(562666), domestic guinea pig Cluh(100734437), naked mole-rat Cluh(101711350)
Gene ID:
Mouse(74148) clustered mitochondria (cluA/CLU1) homolog
Rat(303300) clustered mitochondria (cluA/CLU1) homolog
Zebrafish(562666) clustered mitochondria (cluA/CLU1) homolog
domestic guinea pig(100734437) clustered mitochondria (cluA/CLU1) homolog
naked mole-rat(101711350) clustered mitochondria (cluA/CLU1) homolog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015229 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081158 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081158 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081158 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015229 Rosetta Predictions human pricing
XM_001080615 Rosetta Predictions rat pricing
XM_220693 Rosetta Predictions rat pricing
NM_001081158 Rosetta Predictions mouse pricing
XM_001004959 Rosetta Predictions mouse pricing
XM_001004960 Rosetta Predictions mouse pricing
XM_181333 Rosetta Predictions mouse pricing
XM_902412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113678 predicted 938
2 SASI_Hs01_00113679 predicted 1214
3 SASI_Hs02_00347340 predicted 3796
4 SASI_Hs01_00113681 predicted 862
5 SASI_Hs02_00347341 predicted 1327
6 SASI_Hs01_00113685 predicted 1120
7 SASI_Hs01_00113686 predicted 3644
8 SASI_Hs01_00113687 predicted 1275
9 SASI_Hs02_00347342 predicted 2547
10 SASI_Hs02_00347343 predicted 1216
11 SASI_Hs01_00113680 predicted 793
12 SASI_Hs01_00113682 predicted 1328
13 SASI_Hs01_00113683 predicted 2794
14 SASI_Hs01_00113684 predicted 3596
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368650 predicted 4018
2 SASI_Rn02_00368651 predicted 2173
3 SASI_Rn02_00368652 predicted 3085
4 SASI_Rn02_00368653 predicted 1722
5 SASI_Rn02_00368654 predicted 1713
6 SASI_Rn02_00368655 predicted 1617
7 SASI_Rn02_00368656 predicted 2048
8 SASI_Rn02_00368657 predicted 1088
9 SASI_Rn02_00368658 predicted 835
10 SASI_Rn02_00368659 predicted 4364
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379503 predicted 729
2 SASI_Rn02_00379504 predicted 2432
3 SASI_Rn02_00379505 predicted 3349
4 SASI_Rn02_00379506 predicted 1983
5 SASI_Rn02_00379507 predicted 1975
6 SASI_Rn02_00379508 predicted 1873
7 SASI_Rn02_00379509 predicted 2299
8 SASI_Rn02_00379510 predicted 1342
9 SASI_Rn02_00379511 predicted 1093
10 SASI_Rn02_00379512 predicted 4626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081158 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295751 predicted 1792
2 SASI_Mm02_00295752 predicted 4251
3 SASI_Mm02_00295753 predicted 2079
4 SASI_Mm02_00295754 predicted 2269
5 SASI_Mm02_00295755 predicted 1555
6 SASI_Mm02_00295756 predicted 3304
7 SASI_Mm02_00295757 predicted 480
8 SASI_Mm02_00295758 predicted 2169
9 SASI_Mm02_00295759 predicted 1876
10 SASI_Mm02_00295760 predicted 1452
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265222 predicted 3960
2 SASI_Mm01_00265223 predicted 1910
3 SASI_Mm01_00265224 predicted 4364
4 SASI_Mm01_00265225 predicted 2381
5 SASI_Mm01_00265226 predicted 586
6 SASI_Mm01_00265227 predicted 774
7 SASI_Mm01_00265228 predicted 4133
8 SASI_Mm01_00265229 predicted 3838
9 SASI_Mm01_00265230 predicted 808
10 SASI_Mm01_00265231 predicted 4254
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279508 predicted 4325
2 SASI_Mm01_00279509 predicted 2419
3 SASI_Mm01_00279510 predicted 4728
4 SASI_Mm01_00279511 predicted 2890
5 SASI_Mm01_00279512 predicted 1098
6 SASI_Mm01_00279513 predicted 1284
7 SASI_Mm01_00279514 predicted 4494
8 SASI_Mm01_00279515 predicted 4199
9 SASI_Mm01_00279516 predicted 1324
10 SASI_Mm01_00279517 predicted 4615
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_181333 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205706 predicted 4475
2 SASI_Mm01_00205707 predicted 2422
3 SASI_Mm01_00205708 predicted 4875
4 SASI_Mm01_00205709 predicted 2895
5 SASI_Mm01_00205710 predicted 1101
6 SASI_Mm01_00205711 predicted 1292
7 SASI_Mm01_00205712 predicted 4645
8 SASI_Mm01_00205713 predicted 4351
9 SASI_Mm01_00205714 predicted 1314
10 SASI_Mm01_00205715 predicted 4763
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280084 predicted 1652
2 SASI_Mm01_00280085 predicted 2057
3 SASI_Mm01_00280086 predicted 2350
4 SASI_Mm01_00280087 predicted 2249
5 SASI_Mm01_00280088 predicted 1657
6 SASI_Mm01_00280089 predicted 2178
7 SASI_Mm01_00280090 predicted 1833
8 SASI_Mm01_00280091 predicted 2179
9 SASI_Mm01_00280092 predicted 1945
10 SASI_Mm01_00280093 predicted 1591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015229
VALIDATED
CLUH MISSION shRNA Bacterial Glycerol Stock
clustered mitochondria (cluA/CLU1) homolog
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015229.2-4215s1c1
Sequence:CCGGGCGCTGGTTCAATGAATAGATCTCGAGATCTATTCATTGAACCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015229.2-2572s1c1
Sequence:CCGGGCACATCTTCAAGACGTACTTCTCGAGAAGTACGTCTTGAAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015229.2-1354s1c1
Sequence:CCGGGCAGATGTTCATCTGGAACAACTCGAGTTGTTCCAGATGAACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015229.2-1357s1c1
Sequence:CCGGGATGTTCATCTGGAACAACATCTCGAGATGTTGTTCCAGATGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015229.2-2573s1c1
Sequence:CCGGCACATCTTCAAGACGTACTTACTCGAGTAAGTACGTCTTGAAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015229.3-4196s21c1
Sequence:CCGGGCGCTGGTTCAATGAATAGATCTCGAGATCTATTCATTGAACCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015229.3-2552s21c1
Sequence:CCGGGCACATCTTCAAGACGTACTTCTCGAGAAGTACGTCTTGAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_015229.3-1337s21c1
Sequence:CCGGGATGTTCATCTGGAACAACATCTCGAGATGTTGTTCCAGATGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015229.3-1215s21c1
Sequence:CCGGCTCCGAGAAAGGGCCATATTCCTCGAGGAATATGGCCCTTTCTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015229
VALIDATED
CLUH MISSION shRNA shRNA Plasmid DNA
clustered mitochondria (cluA/CLU1) homolog
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015229.2-4215s1c1
Sequence:CCGGGCGCTGGTTCAATGAATAGATCTCGAGATCTATTCATTGAACCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015229.2-2572s1c1
Sequence:CCGGGCACATCTTCAAGACGTACTTCTCGAGAAGTACGTCTTGAAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015229.2-1354s1c1
Sequence:CCGGGCAGATGTTCATCTGGAACAACTCGAGTTGTTCCAGATGAACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015229.2-1357s1c1
Sequence:CCGGGATGTTCATCTGGAACAACATCTCGAGATGTTGTTCCAGATGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015229.2-2573s1c1
Sequence:CCGGCACATCTTCAAGACGTACTTACTCGAGTAAGTACGTCTTGAAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015229.3-4196s21c1
Sequence:CCGGGCGCTGGTTCAATGAATAGATCTCGAGATCTATTCATTGAACCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015229.3-2552s21c1
Sequence:CCGGGCACATCTTCAAGACGTACTTCTCGAGAAGTACGTCTTGAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_015229.3-1337s21c1
Sequence:CCGGGATGTTCATCTGGAACAACATCTCGAGATGTTGTTCCAGATGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015229.3-1215s21c1
Sequence:CCGGCTCCGAGAAAGGGCCATATTCCTCGAGGAATATGGCCCTTTCTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015229
VALIDATED
CLUH MISSION shRNA Lentiviral Transduction Particles
clustered mitochondria (cluA/CLU1) homolog
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015229.2-4215s1c1
Sequence:CCGGGCGCTGGTTCAATGAATAGATCTCGAGATCTATTCATTGAACCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015229.2-2572s1c1
Sequence:CCGGGCACATCTTCAAGACGTACTTCTCGAGAAGTACGTCTTGAAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015229.2-1354s1c1
Sequence:CCGGGCAGATGTTCATCTGGAACAACTCGAGTTGTTCCAGATGAACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015229.2-1357s1c1
Sequence:CCGGGATGTTCATCTGGAACAACATCTCGAGATGTTGTTCCAGATGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015229.2-2573s1c1
Sequence:CCGGCACATCTTCAAGACGTACTTACTCGAGTAAGTACGTCTTGAAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015229.3-4196s21c1
Sequence:CCGGGCGCTGGTTCAATGAATAGATCTCGAGATCTATTCATTGAACCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015229.3-2552s21c1
Sequence:CCGGGCACATCTTCAAGACGTACTTCTCGAGAAGTACGTCTTGAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_015229.3-1337s21c1
Sequence:CCGGGATGTTCATCTGGAACAACATCTCGAGATGTTGTTCCAGATGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015229.3-1215s21c1
Sequence:CCGGCTCCGAGAAAGGGCCATATTCCTCGAGGAATATGGCCCTTTCTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081158
VALIDATED
CLUH MISSION shRNA Bacterial Glycerol Stock
clustered mitochondria (cluA/CLU1) homolog
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000267769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081158.2-4537s21c1
Sequence:CCGGATGACGTGCAGATGCAATTTCCTCGAGGAAATTGCATCTGCACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081158.2-1806s21c1
Sequence:CCGGTTCGTCACCGAGTACTCAATGCTCGAGCATTGAGTACTCGGTGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081158.2-2300s21c1
Sequence:CCGGAGCCGAGAGGTGATCCGAAATCTCGAGATTTCGGATCACCTCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081158.2-1342s21c1
Sequence:CCGGGCTCCGAGAACGAGCCATATTCTCGAGAATATGGCTCGTTCTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081158
VALIDATED
CLUH MISSION shRNA shRNA Plasmid DNA
clustered mitochondria (cluA/CLU1) homolog
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000267769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081158.2-4537s21c1
Sequence:CCGGATGACGTGCAGATGCAATTTCCTCGAGGAAATTGCATCTGCACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081158.2-1806s21c1
Sequence:CCGGTTCGTCACCGAGTACTCAATGCTCGAGCATTGAGTACTCGGTGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081158.2-2300s21c1
Sequence:CCGGAGCCGAGAGGTGATCCGAAATCTCGAGATTTCGGATCACCTCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081158.2-1342s21c1
Sequence:CCGGGCTCCGAGAACGAGCCATATTCTCGAGAATATGGCTCGTTCTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081158
VALIDATED
CLUH MISSION shRNA Lentiviral Transduction Particles
clustered mitochondria (cluA/CLU1) homolog
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000267769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081158.2-4537s21c1
Sequence:CCGGATGACGTGCAGATGCAATTTCCTCGAGGAAATTGCATCTGCACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081158.2-1806s21c1
Sequence:CCGGTTCGTCACCGAGTACTCAATGCTCGAGCATTGAGTACTCGGTGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081158.2-2300s21c1
Sequence:CCGGAGCCGAGAGGTGATCCGAAATCTCGAGATTTCGGATCACCTCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081158.2-1342s21c1
Sequence:CCGGGCTCCGAGAACGAGCCATATTCTCGAGAATATGGCTCGTTCTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks