EMAIL THIS PAGE TO A FRIEND

CLUL1

clusterin-like 1 (retinal)

Synonyms: RA337M
UniProtKB ID: Q15846
Gene ID:
Rat(367345) clusterin-like 1 (retinal)
Zebrafish(559018) clusterin-like 1 (retinal)
cow(516801) clusterin-like 1 (retinal)
domestic cat(101091483) clusterin-like 1 (retinal)
dog(403747) clusterin-like 1 (retinal)
chicken(768430) clusterin-like 1 (retinal)
naked mole-rat(101711323) clusterin-like 1 (retinal)
domestic guinea pig(100720265) clusterin-like 1 (retinal)
sheep(101103443) clusterin-like 1 (retinal)
Domestic Rabbit(100348400) clusterin-like 1 (retinal)
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199167 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062011 MISSION® esiRNA esiRNA human CLUL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014410 Rosetta Predictions human pricing
NM_199167 Rosetta Predictions human pricing
NM_001033071 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041892 predicted 808
2 SASI_Hs01_00041893 predicted 684
3 SASI_Hs01_00041894 predicted 902
4 SASI_Hs01_00041897 predicted 1467
5 SASI_Hs02_00345599 predicted 1390
6 SASI_Hs02_00345600 predicted 644
7 SASI_Hs01_00041898 predicted 963
8 SASI_Hs02_00345601 predicted 750
9 SASI_Hs01_00041900 predicted 1220
10 SASI_Hs01_00041901 predicted 351
11 SASI_Hs01_00041895 predicted 1324
12 SASI_Hs01_00041896 predicted 847
13 SASI_Hs01_00041899 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235076 predicted 730
2 SASI_Hs01_00235077 predicted 612
3 SASI_Hs01_00235078 predicted 835
4 SASI_Hs01_00235081 predicted 1401
5 SASI_Hs02_00372599 predicted 1313
6 SASI_Hs02_00372600 predicted 573
7 SASI_Hs01_00235082 predicted 891
8 SASI_Hs02_00372601 predicted 673
9 SASI_Hs01_00235084 predicted 1154
10 SASI_Hs01_00235085 predicted 276
11 SASI_Hs01_00235079 predicted 1250
12 SASI_Hs01_00235080 predicted 765
13 SASI_Hs01_00235083 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114359 predicted 1173
2 SASI_Rn01_00114360 predicted 956
3 SASI_Rn01_00114361 predicted 949
4 SASI_Rn01_00114362 predicted 1113
5 SASI_Rn01_00114363 predicted 905
6 SASI_Rn01_00114364 predicted 353
7 SASI_Rn01_00114365 predicted 854
8 SASI_Rn01_00114366 predicted 555
9 SASI_Rn01_00114367 predicted 1125
10 SASI_Rn02_00203637 predicted 880
11 SASI_Rn01_00114368 predicted 1199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199167
CLUL1 MISSION shRNA Bacterial Glycerol Stock
clusterin-like 1 (retinal)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199167.1-1571s1c1
Sequence:CCGGGCAGGAAAGTATGTTAGCTATCTCGAGATAGCTAACATACTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144493    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199167.1-1557s1c1
Sequence:CCGGCAATAAACACAGTTGCAGGAACTCGAGTTCCTGCAACTGTGTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199167.1-1400s1c1
Sequence:CCGGGAGTTCTAACTTCATTGGCTACTCGAGTAGCCAATGAAGTTAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199167.1-1484s1c1
Sequence:CCGGGCATCCTATATCCAGTAAGTACTCGAGTACTTACTGGATATAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199167.1-1108s1c1
Sequence:CCGGCGATCAGGTTGGTCAATGTATCTCGAGATACATTGACCAACCTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199167.1-816s1c1
Sequence:CCGGCCCAACTTCTTCCAGCTGTTTCTCGAGAAACAGCTGGAAGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199167.1-938s1c1
Sequence:CCGGCGGAGGCCTGATTTCAAAGATCTCGAGATCTTTGAAATCAGGCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199167.1-1107s1c1
Sequence:CCGGGCGATCAGGTTGGTCAATGTACTCGAGTACATTGACCAACCTGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199167.1-1112s1c1
Sequence:CCGGCAGGTTGGTCAATGTATCCAACTCGAGTTGGATACATTGACCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199167.1-270s1c1
Sequence:CCGGGAGAAGGAACACACCAATCTACTCGAGTAGATTGGTGTGTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199167
CLUL1 MISSION shRNA shRNA Plasmid DNA
clusterin-like 1 (retinal)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199167.1-1571s1c1
Sequence:CCGGGCAGGAAAGTATGTTAGCTATCTCGAGATAGCTAACATACTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144493    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199167.1-1557s1c1
Sequence:CCGGCAATAAACACAGTTGCAGGAACTCGAGTTCCTGCAACTGTGTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199167.1-1400s1c1
Sequence:CCGGGAGTTCTAACTTCATTGGCTACTCGAGTAGCCAATGAAGTTAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199167.1-1484s1c1
Sequence:CCGGGCATCCTATATCCAGTAAGTACTCGAGTACTTACTGGATATAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199167.1-1108s1c1
Sequence:CCGGCGATCAGGTTGGTCAATGTATCTCGAGATACATTGACCAACCTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199167.1-816s1c1
Sequence:CCGGCCCAACTTCTTCCAGCTGTTTCTCGAGAAACAGCTGGAAGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199167.1-938s1c1
Sequence:CCGGCGGAGGCCTGATTTCAAAGATCTCGAGATCTTTGAAATCAGGCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199167.1-1107s1c1
Sequence:CCGGGCGATCAGGTTGGTCAATGTACTCGAGTACATTGACCAACCTGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199167.1-1112s1c1
Sequence:CCGGCAGGTTGGTCAATGTATCCAACTCGAGTTGGATACATTGACCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199167.1-270s1c1
Sequence:CCGGGAGAAGGAACACACCAATCTACTCGAGTAGATTGGTGTGTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199167
CLUL1 MISSION shRNA Lentiviral Transduction Particles
clusterin-like 1 (retinal)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199167.1-1571s1c1
Sequence:CCGGGCAGGAAAGTATGTTAGCTATCTCGAGATAGCTAACATACTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144493    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199167.1-1557s1c1
Sequence:CCGGCAATAAACACAGTTGCAGGAACTCGAGTTCCTGCAACTGTGTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199167.1-1400s1c1
Sequence:CCGGGAGTTCTAACTTCATTGGCTACTCGAGTAGCCAATGAAGTTAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199167.1-1484s1c1
Sequence:CCGGGCATCCTATATCCAGTAAGTACTCGAGTACTTACTGGATATAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199167.1-1108s1c1
Sequence:CCGGCGATCAGGTTGGTCAATGTATCTCGAGATACATTGACCAACCTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199167.1-816s1c1
Sequence:CCGGCCCAACTTCTTCCAGCTGTTTCTCGAGAAACAGCTGGAAGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199167.1-938s1c1
Sequence:CCGGCGGAGGCCTGATTTCAAAGATCTCGAGATCTTTGAAATCAGGCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199167.1-1107s1c1
Sequence:CCGGGCGATCAGGTTGGTCAATGTACTCGAGTACATTGACCAACCTGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199167.1-1112s1c1
Sequence:CCGGCAGGTTGGTCAATGTATCCAACTCGAGTTGGATACATTGACCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199167.1-270s1c1
Sequence:CCGGGAGAAGGAACACACCAATCTACTCGAGTAGATTGGTGTGTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks