EMAIL THIS PAGE TO A FRIEND

CLVS1

clavesin 1

216 Gene Product Result for
Synonyms: CRALBPL RLBP1L1
UniProtKB ID: Q8IUQ0, B2R7M5, C8UZT3, Q8NB32
Gene ID:
Mouse(74438) clavesin 1
Rat(366311) clavesin 1
chicken(421141) clavesin 1
Horse(100065933) clavesin 1
cow(532808) clavesin 1
dog(486969) clavesin 1
sheep(101117938) clavesin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173519 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_359383 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_359383 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_359383 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133071 MISSION® esiRNA esiRNA human RLBP1L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173519 Rosetta Predictions human pricing
NM_001108969 Rosetta Predictions rat pricing
XM_575768 Rosetta Predictions rat pricing
NM_028940 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166978 predicted 631
2 SASI_Hs01_00166979 predicted 908
3 SASI_Hs01_00166980 predicted 364
4 SASI_Hs01_00166981 predicted 789
5 SASI_Hs02_00368300 predicted 352
6 SASI_Hs01_00166982 predicted 1199
7 SASI_Hs01_00166983 predicted 455
8 SASI_Hs01_00166984 predicted 924
9 SASI_Hs01_00166985 predicted 596
10 SASI_Hs01_00166987 predicted 1183
11 SASI_Hs01_00166986 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108969 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243874 predicted 974
2 SASI_Rn02_00243875 predicted 830
3 SASI_Rn02_00243876 predicted 1010
4 SASI_Rn02_00243877 predicted 788
5 SASI_Rn02_00243878 predicted 1617
6 SASI_Rn02_00243879 predicted 1119
7 SASI_Rn02_00243880 predicted 1388
8 SASI_Rn02_00243881 predicted 1300
9 SASI_Rn02_00243882 predicted 556
10 SASI_Rn02_00243883 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127299 predicted 1057
2 SASI_Rn01_00127300 predicted 959
3 SASI_Rn01_00127301 predicted 956
4 SASI_Rn01_00127302 predicted 946
5 SASI_Rn01_00127303 predicted 1078
6 SASI_Rn01_00127304 predicted 946
7 SASI_Rn01_00127305 predicted 1046
8 SASI_Rn01_00127306 predicted 959
9 SASI_Rn01_00127307 predicted 940
10 SASI_Rn01_00127308 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028940 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090867 predicted 622
2 SASI_Mm01_00090868 predicted 617
3 SASI_Mm01_00090869 predicted 905
4 SASI_Mm02_00334643 predicted 675
5 SASI_Mm01_00090870 predicted 729
6 SASI_Mm01_00090871 predicted 1183
7 SASI_Mm01_00090872 predicted 974
8 SASI_Mm01_00090873 predicted 308
9 SASI_Mm01_00090874 predicted 438
10 SASI_Mm01_00090875 predicted 1017
11 SASI_Mm01_00090866 predicted 689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173519
CLVS1 MISSION shRNA Bacterial Glycerol Stock
clavesin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173519.1-1017s1c1
Sequence:CCGGCTTAAAGACAAGACCAGGAAACTCGAGTTTCCTGGTCTTGTCTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173519.1-1884s1c1
Sequence:CCGGGCATCGAATTGTTCAGCCTAACTCGAGTTAGGCTGAACAATTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173519.1-888s1c1
Sequence:CCGGCTGACACCTTCAATCCTTAAACTCGAGTTTAAGGATTGAAGGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173519.1-1077s1c1
Sequence:CCGGCAGCTAATACACCCTGAATTTCTCGAGAAATTCAGGGTGTATTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173519.1-2801s1c1
Sequence:CCGGCCCTATTGGTAGAGAACAATACTCGAGTATTGTTCTCTACCAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173519.1-1188s1c1
Sequence:CCGGGACTATACTCACACATCCTATCTCGAGATAGGATGTGTGAGTATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173519.2-838s21c1
Sequence:CCGGGATCCGGAGCTTCAGATAAATCTCGAGATTTATCTGAAGCTCCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173519.2-660s21c1
Sequence:CCGGGGCAGATGATCCCGGCATTAACTCGAGTTAATGCCGGGATCATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173519
CLVS1 MISSION shRNA shRNA Plasmid DNA
clavesin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173519.1-1017s1c1
Sequence:CCGGCTTAAAGACAAGACCAGGAAACTCGAGTTTCCTGGTCTTGTCTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173519.1-1884s1c1
Sequence:CCGGGCATCGAATTGTTCAGCCTAACTCGAGTTAGGCTGAACAATTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173519.1-888s1c1
Sequence:CCGGCTGACACCTTCAATCCTTAAACTCGAGTTTAAGGATTGAAGGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173519.1-1077s1c1
Sequence:CCGGCAGCTAATACACCCTGAATTTCTCGAGAAATTCAGGGTGTATTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173519.1-2801s1c1
Sequence:CCGGCCCTATTGGTAGAGAACAATACTCGAGTATTGTTCTCTACCAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173519.1-1188s1c1
Sequence:CCGGGACTATACTCACACATCCTATCTCGAGATAGGATGTGTGAGTATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173519.2-838s21c1
Sequence:CCGGGATCCGGAGCTTCAGATAAATCTCGAGATTTATCTGAAGCTCCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173519.2-660s21c1
Sequence:CCGGGGCAGATGATCCCGGCATTAACTCGAGTTAATGCCGGGATCATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173519
CLVS1 MISSION shRNA Lentiviral Transduction Particles
clavesin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173519.1-1017s1c1
Sequence:CCGGCTTAAAGACAAGACCAGGAAACTCGAGTTTCCTGGTCTTGTCTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173519.1-1884s1c1
Sequence:CCGGGCATCGAATTGTTCAGCCTAACTCGAGTTAGGCTGAACAATTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173519.1-888s1c1
Sequence:CCGGCTGACACCTTCAATCCTTAAACTCGAGTTTAAGGATTGAAGGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173519.1-1077s1c1
Sequence:CCGGCAGCTAATACACCCTGAATTTCTCGAGAAATTCAGGGTGTATTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173519.1-2801s1c1
Sequence:CCGGCCCTATTGGTAGAGAACAATACTCGAGTATTGTTCTCTACCAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173519.1-1188s1c1
Sequence:CCGGGACTATACTCACACATCCTATCTCGAGATAGGATGTGTGAGTATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173519.2-838s21c1
Sequence:CCGGGATCCGGAGCTTCAGATAAATCTCGAGATTTATCTGAAGCTCCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173519.2-660s21c1
Sequence:CCGGGGCAGATGATCCCGGCATTAACTCGAGTTAATGCCGGGATCATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_359383
CLVS1 MISSION shRNA Bacterial Glycerol Stock
clavesin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359383.1-220s1c1
Sequence:CCGGGCCTTCATTCTGCGATTTCTTCTCGAGAAGAAATCGCAGAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359383.1-208s1c1
Sequence:CCGGCGTACAGATGATGCCTTCATTCTCGAGAATGAAGGCATCATCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359383.1-216s1c1
Sequence:CCGGTGATGCCTTCATTCTGCGATTCTCGAGAATCGCAGAATGAAGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359383.1-112s1c1
Sequence:CCGGGCTCGTCTGGAACTGAATGAACTCGAGTTCATTCAGTTCCAGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359383.1-156s1c1
Sequence:CCGGCATTCAACAAGTCAGAGACATCTCGAGATGTCTCTGACTTGTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_359383
CLVS1 MISSION shRNA shRNA Plasmid DNA
clavesin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359383.1-220s1c1
Sequence:CCGGGCCTTCATTCTGCGATTTCTTCTCGAGAAGAAATCGCAGAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359383.1-208s1c1
Sequence:CCGGCGTACAGATGATGCCTTCATTCTCGAGAATGAAGGCATCATCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359383.1-216s1c1
Sequence:CCGGTGATGCCTTCATTCTGCGATTCTCGAGAATCGCAGAATGAAGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359383.1-112s1c1
Sequence:CCGGGCTCGTCTGGAACTGAATGAACTCGAGTTCATTCAGTTCCAGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359383.1-156s1c1
Sequence:CCGGCATTCAACAAGTCAGAGACATCTCGAGATGTCTCTGACTTGTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_359383
CLVS1 MISSION shRNA Lentiviral Transduction Particles
clavesin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359383.1-220s1c1
Sequence:CCGGGCCTTCATTCTGCGATTTCTTCTCGAGAAGAAATCGCAGAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359383.1-208s1c1
Sequence:CCGGCGTACAGATGATGCCTTCATTCTCGAGAATGAAGGCATCATCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359383.1-216s1c1
Sequence:CCGGTGATGCCTTCATTCTGCGATTCTCGAGAATCGCAGAATGAAGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359383.1-112s1c1
Sequence:CCGGGCTCGTCTGGAACTGAATGAACTCGAGTTCATTCAGTTCCAGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359383.1-156s1c1
Sequence:CCGGCATTCAACAAGTCAGAGACATCTCGAGATGTCTCTGACTTGTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks