EMAIL THIS PAGE TO A FRIEND

CLVS2

clavesin 2

57 Gene Product Result for
Synonyms: C6orf212 C6orf213 RLBP1L2 bA160A10.4
UniProtKB ID: Q5SYC1, B3KTG5, B4DHL0, C8UZT4, Q5SYC0
Gene ID:
Mouse(215890) clavesin 2
Rat(361459) clavesin 2
sheep(101120248) clavesin 2
Zebrafish(566769) clavesin 2
cow(534359) clavesin 2
Horse(100072980) clavesin 2
dog(484109) clavesin 2
chicken(428616) clavesin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010852 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010852 Rosetta Predictions human pricing
NM_001108459 Rosetta Predictions rat pricing
NM_175448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144398 predicted 1756
2 SASI_Hs01_00144399 predicted 1447
3 SASI_Hs01_00144400 predicted 1425
4 SASI_Hs01_00144401 predicted 1317
5 SASI_Hs01_00144402 predicted 1562
6 SASI_Hs01_00144403 predicted 1645
7 SASI_Hs02_00305791 predicted 1014
8 SASI_Hs01_00144404 predicted 1462
9 SASI_Hs01_00144405 predicted 993
10 SASI_Hs01_00144406 predicted 1548
11 SASI_Hs01_00144397 predicted 1361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238849 predicted 1046
2 SASI_Rn02_00238850 predicted 1198
3 SASI_Rn02_00238851 predicted 1084
4 SASI_Rn02_00238852 predicted 1219
5 SASI_Rn02_00238853 predicted 1169
6 SASI_Rn02_00238854 predicted 1113
7 SASI_Rn02_00238855 predicted 1296
8 SASI_Rn02_00238856 predicted 1056
9 SASI_Rn02_00238857 predicted 1066
10 SASI_Rn02_00238858 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123432 predicted 1026
2 SASI_Mm01_00123433 predicted 1545
3 SASI_Mm01_00123434 predicted 714
4 SASI_Mm01_00123435 predicted 1074
5 SASI_Mm01_00123436 predicted 1308
6 SASI_Mm01_00123437 predicted 927
7 SASI_Mm01_00123438 predicted 1042
8 SASI_Mm01_00123439 predicted 1481
9 SASI_Mm01_00123440 predicted 1093
10 SASI_Mm01_00123441 predicted 1674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010852
CLVS2 MISSION shRNA Bacterial Glycerol Stock
clavesin 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010852.2-1434s21c1
Sequence:CCGGGATAGTTTCCCAGCGCGATTTCTCGAGAAATCGCGCTGGGAAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010852.2-1836s21c1
Sequence:CCGGTTGCTTTCTCTGGACTAATAACTCGAGTTATTAGTCCAGAGAAAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010852.2-1258s21c1
Sequence:CCGGGGTACACACTGGTGGATATTTCTCGAGAAATATCCACCAGTGTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010852.2-1469s21c1
Sequence:CCGGTGTCAATCAACCATGGTATATCTCGAGATATACCATGGTTGATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010852.2-1401s21c1
Sequence:CCGGAGTATGCTGCGATTAGCTATTCTCGAGAATAGCTAATCGCAGCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010852.1-158s1c1
Sequence:CCGGCTGGAGTAACTTCACTTTCAACTCGAGTTGAAAGTGAAGTTACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010852.1-491s1c1
Sequence:CCGGCGAGTACAATGTAGACTCCTACTCGAGTAGGAGTCTACATTGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010852.1-368s1c1
Sequence:CCGGGAACAGTCTACACCAACTAATCTCGAGATTAGTTGGTGTAGACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010852.1-568s1c1
Sequence:CCGGCTCAATCAGTAGTGGATCCTACTCGAGTAGGATCCACTACTGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010852.1-457s1c1
Sequence:CCGGGAACACTGCTAGACCATGAATCTCGAGATTCATGGTCTAGCAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010852.1-354s1c1
Sequence:CCGGCATGGTAACAACCTGAACAGTCTCGAGACTGTTCAGGTTGTTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010852
CLVS2 MISSION shRNA shRNA Plasmid DNA
clavesin 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010852.2-1434s21c1
Sequence:CCGGGATAGTTTCCCAGCGCGATTTCTCGAGAAATCGCGCTGGGAAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010852.2-1836s21c1
Sequence:CCGGTTGCTTTCTCTGGACTAATAACTCGAGTTATTAGTCCAGAGAAAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010852.2-1258s21c1
Sequence:CCGGGGTACACACTGGTGGATATTTCTCGAGAAATATCCACCAGTGTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010852.2-1469s21c1
Sequence:CCGGTGTCAATCAACCATGGTATATCTCGAGATATACCATGGTTGATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010852.2-1401s21c1
Sequence:CCGGAGTATGCTGCGATTAGCTATTCTCGAGAATAGCTAATCGCAGCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010852.1-158s1c1
Sequence:CCGGCTGGAGTAACTTCACTTTCAACTCGAGTTGAAAGTGAAGTTACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010852.1-491s1c1
Sequence:CCGGCGAGTACAATGTAGACTCCTACTCGAGTAGGAGTCTACATTGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010852.1-368s1c1
Sequence:CCGGGAACAGTCTACACCAACTAATCTCGAGATTAGTTGGTGTAGACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010852.1-568s1c1
Sequence:CCGGCTCAATCAGTAGTGGATCCTACTCGAGTAGGATCCACTACTGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010852.1-457s1c1
Sequence:CCGGGAACACTGCTAGACCATGAATCTCGAGATTCATGGTCTAGCAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010852.1-354s1c1
Sequence:CCGGCATGGTAACAACCTGAACAGTCTCGAGACTGTTCAGGTTGTTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010852
CLVS2 MISSION shRNA Lentiviral Transduction Particles
clavesin 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010852.2-1434s21c1
Sequence:CCGGGATAGTTTCCCAGCGCGATTTCTCGAGAAATCGCGCTGGGAAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010852.2-1836s21c1
Sequence:CCGGTTGCTTTCTCTGGACTAATAACTCGAGTTATTAGTCCAGAGAAAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010852.2-1258s21c1
Sequence:CCGGGGTACACACTGGTGGATATTTCTCGAGAAATATCCACCAGTGTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010852.2-1469s21c1
Sequence:CCGGTGTCAATCAACCATGGTATATCTCGAGATATACCATGGTTGATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010852.2-1401s21c1
Sequence:CCGGAGTATGCTGCGATTAGCTATTCTCGAGAATAGCTAATCGCAGCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010852.1-158s1c1
Sequence:CCGGCTGGAGTAACTTCACTTTCAACTCGAGTTGAAAGTGAAGTTACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010852.1-491s1c1
Sequence:CCGGCGAGTACAATGTAGACTCCTACTCGAGTAGGAGTCTACATTGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010852.1-368s1c1
Sequence:CCGGGAACAGTCTACACCAACTAATCTCGAGATTAGTTGGTGTAGACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010852.1-568s1c1
Sequence:CCGGCTCAATCAGTAGTGGATCCTACTCGAGTAGGATCCACTACTGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010852.1-457s1c1
Sequence:CCGGGAACACTGCTAGACCATGAATCTCGAGATTCATGGTCTAGCAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010852.1-354s1c1
Sequence:CCGGCATGGTAACAACCTGAACAGTCTCGAGACTGTTCAGGTTGTTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175448
CLVS2 MISSION shRNA Bacterial Glycerol Stock
clavesin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175448.2-1872s1c1
Sequence:CCGGGCCAGTGATATGGACTACAATCTCGAGATTGTAGTCCATATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175448.2-1303s1c1
Sequence:CCGGCCAACTAATTCATCCTGAGATCTCGAGATCTCAGGATGAATTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175448.2-1514s1c1
Sequence:CCGGGCACTGAAACGAATGGATAAACTCGAGTTTATCCATTCGTTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175448.2-1044s1c1
Sequence:CCGGCAGAGCTTCAAGTAAATGGATCTCGAGATCCATTTACTTGAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175448.2-1388s1c1
Sequence:CCGGCTAGACCATGAGTATGATGATCTCGAGATCATCATACTCATGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175448
CLVS2 MISSION shRNA shRNA Plasmid DNA
clavesin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175448.2-1872s1c1
Sequence:CCGGGCCAGTGATATGGACTACAATCTCGAGATTGTAGTCCATATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175448.2-1303s1c1
Sequence:CCGGCCAACTAATTCATCCTGAGATCTCGAGATCTCAGGATGAATTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175448.2-1514s1c1
Sequence:CCGGGCACTGAAACGAATGGATAAACTCGAGTTTATCCATTCGTTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175448.2-1044s1c1
Sequence:CCGGCAGAGCTTCAAGTAAATGGATCTCGAGATCCATTTACTTGAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175448.2-1388s1c1
Sequence:CCGGCTAGACCATGAGTATGATGATCTCGAGATCATCATACTCATGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175448
CLVS2 MISSION shRNA Lentiviral Transduction Particles
clavesin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175448.2-1872s1c1
Sequence:CCGGGCCAGTGATATGGACTACAATCTCGAGATTGTAGTCCATATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175448.2-1303s1c1
Sequence:CCGGCCAACTAATTCATCCTGAGATCTCGAGATCTCAGGATGAATTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175448.2-1514s1c1
Sequence:CCGGGCACTGAAACGAATGGATAAACTCGAGTTTATCCATTCGTTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175448.2-1044s1c1
Sequence:CCGGCAGAGCTTCAAGTAAATGGATCTCGAGATCCATTTACTTGAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175448.2-1388s1c1
Sequence:CCGGCTAGACCATGAGTATGATGATCTCGAGATCATCATACTCATGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks