EMAIL THIS PAGE TO A FRIEND

CLYBL

citrate lyase beta like

89 Gene Product Result for
Synonyms: CLB bA134O15.1
UniProtKB ID: Q8N0X4, Q5W0F7, Q8TDH8
Gene ID:
Mouse(69634) citrate lyase beta like
Rat(306198) citrate lyase beta like
Zebrafish(641475) citrate lyase beta-like
cow(533186) citrate lyase beta like
domestic cat(101083646) citrate lyase beta like
dog(476974) citrate lyase beta like
chicken(418775) citrate lyase beta like
sheep(101111978) citrate lyase beta like
domestic guinea pig(100736152) citrate lyase beta like
naked mole-rat(101714232) citrate lyase beta like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029556 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029556 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029556 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138280 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138280 Rosetta Predictions human pricing
NM_206808 Rosetta Predictions human pricing
XM_001075314 Rosetta Predictions rat pricing
XM_001075344 Rosetta Predictions rat pricing
XM_240311 Rosetta Predictions rat pricing
NM_029556 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226749 predicted 570
2 SASI_Hs01_00226750 predicted 829
3 SASI_Hs01_00226751 predicted 763
4 SASI_Hs01_00226752 predicted 723
5 SASI_Hs01_00226753 predicted 736
6 SASI_Hs01_00226754 predicted 333
7 SASI_Hs01_00226755 predicted 716
8 SASI_Hs01_00226756 predicted 600
9 SASI_Hs01_00226757 predicted 733
10 SASI_Hs01_00226758 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373516 predicted 892
2 SASI_Hs02_00373517 predicted 938
3 SASI_Hs01_00101399 predicted 724
4 SASI_Hs01_00101402 predicted 597
5 SASI_Hs02_00373518 predicted 644
6 SASI_Hs02_00373519 predicted 297
7 SASI_Hs02_00373520 predicted 730
8 SASI_Hs02_00373521 predicted 204
9 SASI_Hs02_00373522 predicted 945
10 SASI_Hs02_00373523 predicted 641
11 SASI_Hs01_00101395 predicted 572
12 SASI_Hs01_00101396 predicted 819
13 SASI_Hs01_00101397 predicted 763
14 SASI_Hs01_00101398 predicted 720
15 SASI_Hs01_00101400 predicted 334
16 SASI_Hs01_00101401 predicted 710
17 SASI_Hs01_00101403 predicted 734
18 SASI_Hs01_00101404 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075314 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349300 predicted 871
2 SASI_Rn02_00349301 predicted 443
3 SASI_Rn02_00349302 predicted 316
4 SASI_Rn02_00349303 predicted 431
5 SASI_Rn02_00349304 predicted 384
6 SASI_Rn02_00349305 predicted 701
7 SASI_Rn02_00349306 predicted 552
8 SASI_Rn02_00349307 predicted 932
9 SASI_Rn02_00349308 predicted 502
10 SASI_Rn02_00349309 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349416 predicted 875
2 SASI_Rn02_00349417 predicted 707
3 SASI_Rn02_00349418 predicted 387
4 SASI_Rn02_00349419 predicted 696
5 SASI_Rn02_00349420 predicted 429
6 SASI_Rn02_00349421 predicted 553
7 SASI_Rn02_00349422 predicted 940
8 SASI_Rn02_00349423 predicted 498
9 SASI_Rn02_00349424 predicted 457
10 SASI_Rn02_00349425 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_240311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391574 predicted 906
2 SASI_Rn02_00391575 predicted 331
3 SASI_Rn02_00391576 predicted 493
4 SASI_Rn02_00391577 predicted 395
5 SASI_Rn02_00391578 predicted 733
6 SASI_Rn02_00391579 predicted 581
7 SASI_Rn02_00391580 predicted 974
8 SASI_Rn02_00391581 predicted 300
9 SASI_Rn02_00391582 predicted 400
10 SASI_Rn02_00391583 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179721 predicted 369
2 SASI_Mm01_00179722 predicted 382
3 SASI_Mm01_00179723 predicted 312
4 SASI_Mm01_00179725 predicted 948
5 SASI_Mm01_00179726 predicted 419
6 SASI_Mm01_00179727 predicted 922
7 SASI_Mm01_00179728 predicted 325
8 SASI_Mm01_00179729 predicted 255
9 SASI_Mm01_00179730 predicted 505
10 SASI_Mm02_00335509 predicted 704
11 SASI_Mm01_00179724 predicted 722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029556
VALIDATED
CLYBL MISSION shRNA Bacterial Glycerol Stock
citrate lyase beta like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029556.2-1052s1c1
Sequence:CCGGCTGAATGGATACTGTGGGCTTCTCGAGAAGCCCACAGTATCCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029556.2-420s1c1
Sequence:CCGGCCTGAAGAAATCCGATGGTTTCTCGAGAAACCATCGGATTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029556.2-717s1c1
Sequence:CCGGGCCATAGATCTTGTGTACATTCTCGAGAATGTACACAAGATCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029556.2-831s1c1
Sequence:CCGGGCAGTGGTACAGGAACAGTTTCTCGAGAAACTGTTCCTGTACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029556.2-941s1c1
Sequence:CCGGCCGAGGAAGTATGATCGACATCTCGAGATGTCGATCATACTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029556
VALIDATED
CLYBL MISSION shRNA shRNA Plasmid DNA
citrate lyase beta like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029556.2-1052s1c1
Sequence:CCGGCTGAATGGATACTGTGGGCTTCTCGAGAAGCCCACAGTATCCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029556.2-420s1c1
Sequence:CCGGCCTGAAGAAATCCGATGGTTTCTCGAGAAACCATCGGATTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029556.2-717s1c1
Sequence:CCGGGCCATAGATCTTGTGTACATTCTCGAGAATGTACACAAGATCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029556.2-831s1c1
Sequence:CCGGGCAGTGGTACAGGAACAGTTTCTCGAGAAACTGTTCCTGTACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029556.2-941s1c1
Sequence:CCGGCCGAGGAAGTATGATCGACATCTCGAGATGTCGATCATACTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029556
VALIDATED
CLYBL MISSION shRNA Lentiviral Transduction Particles
citrate lyase beta like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029556.2-1052s1c1
Sequence:CCGGCTGAATGGATACTGTGGGCTTCTCGAGAAGCCCACAGTATCCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029556.2-420s1c1
Sequence:CCGGCCTGAAGAAATCCGATGGTTTCTCGAGAAACCATCGGATTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029556.2-717s1c1
Sequence:CCGGGCCATAGATCTTGTGTACATTCTCGAGAATGTACACAAGATCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029556.2-831s1c1
Sequence:CCGGGCAGTGGTACAGGAACAGTTTCTCGAGAAACTGTTCCTGTACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029556.2-941s1c1
Sequence:CCGGCCGAGGAAGTATGATCGACATCTCGAGATGTCGATCATACTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138280
VALIDATED
CLYBL MISSION shRNA Bacterial Glycerol Stock
citrate lyase beta like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138280.3-1129s1c1
Sequence:CCGGCCTGTGTCAAATCCGTCCATTCTCGAGAATGGACGGATTTGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138280.3-640s1c1
Sequence:CCGGCCAGCATAGGTGCAACAAGTACTCGAGTACTTGTTGCACCTATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138280.3-154s1c1
Sequence:CCGGCAGTGCTTTATGTACCTGGAACTCGAGTTCCAGGTACATAAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138280.3-643s1c1
Sequence:CCGGGCATAGGTGCAACAAGTAGTACTCGAGTACTACTTGTTGCACCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138280.3-956s1c1
Sequence:CCGGCCAAGGGAGTATGATCGACATCTCGAGATGTCGATCATACTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138280
VALIDATED
CLYBL MISSION shRNA shRNA Plasmid DNA
citrate lyase beta like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138280.3-1129s1c1
Sequence:CCGGCCTGTGTCAAATCCGTCCATTCTCGAGAATGGACGGATTTGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138280.3-640s1c1
Sequence:CCGGCCAGCATAGGTGCAACAAGTACTCGAGTACTTGTTGCACCTATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138280.3-154s1c1
Sequence:CCGGCAGTGCTTTATGTACCTGGAACTCGAGTTCCAGGTACATAAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138280.3-643s1c1
Sequence:CCGGGCATAGGTGCAACAAGTAGTACTCGAGTACTACTTGTTGCACCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138280.3-956s1c1
Sequence:CCGGCCAAGGGAGTATGATCGACATCTCGAGATGTCGATCATACTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138280
VALIDATED
CLYBL MISSION shRNA Lentiviral Transduction Particles
citrate lyase beta like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138280.3-1129s1c1
Sequence:CCGGCCTGTGTCAAATCCGTCCATTCTCGAGAATGGACGGATTTGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138280.3-640s1c1
Sequence:CCGGCCAGCATAGGTGCAACAAGTACTCGAGTACTTGTTGCACCTATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138280.3-154s1c1
Sequence:CCGGCAGTGCTTTATGTACCTGGAACTCGAGTTCCAGGTACATAAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138280.3-643s1c1
Sequence:CCGGGCATAGGTGCAACAAGTAGTACTCGAGTACTACTTGTTGCACCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138280.3-956s1c1
Sequence:CCGGCCAAGGGAGTATGATCGACATCTCGAGATGTCGATCATACTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks