EMAIL THIS PAGE TO A FRIEND

CMA1

chymase 1, mast cell

54 Gene Product Result for
Synonyms: CYH MCT1 chymase
UniProtKB ID: P23946, B5BUM8, Q16018, Q3SY36, Q9UDH5
Gene ID:
Human(1215) Summary: This gene product is a chymotryptic serine proteinase that belongs to the peptidase family S1. It is expressed in mast cells and thought to function in the degradation of the extracellular matrix, the regulation of submucosal gland secretion, and the generation of vasoactive peptides. In the heart and blood vessels, this protein, rather than angiotensin converting enzyme, is largely responsible for converting angiotensin I to the vasoactive peptide angiotensin II. Angiotensin II has been implicated in blood pressure control and in the pathogenesis of hypertension, cardiac hypertrophy, and heart failure. Thus, this gene product is a target for cardiovascular disease therapies. This gene maps to 14q11.2 in a cluster of genes encoding other proteases. [provided by RefSeq, Jul 2008]
Mouse(17228) chymase 1, mast cell
Rat(25627) chymase 1, mast cell
domestic cat(101084796) chymase 1, mast cell
dog(490628) chymase 1, mast cell
sheep(100144428) chymase 1, mast cell
domestic guinea pig(100135503) chymase 1, mast cell
naked mole-rat(101714600) chymase 1, mast cell
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001836 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU096681 MISSION® esiRNA esiRNA human CMA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001836 Rosetta Predictions human pricing
NM_013092 Rosetta Predictions rat pricing
NM_010780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203554 predicted 351
2 SASI_Hs01_00203555 predicted 301
3 SASI_Hs01_00203556 predicted 344
4 SASI_Hs01_00203558 predicted 305
5 SASI_Hs01_00203559 predicted 498
6 SASI_Hs01_00203560 predicted 293
7 SASI_Hs01_00203561 predicted 262
8 SASI_Hs01_00203562 predicted 499
9 SASI_Hs01_00203563 predicted 340
10 SASI_Hs02_00332642 predicted 248
11 SASI_Hs01_00203557 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070778 predicted 228
2 SASI_Rn01_00070779 predicted 683
3 SASI_Rn01_00070780 predicted 731
4 SASI_Rn01_00070781 predicted 726
5 SASI_Rn01_00070782 predicted 391
6 SASI_Rn01_00070783 predicted 674
7 SASI_Rn01_00070784 predicted 256
8 SASI_Rn01_00070785 predicted 332
9 SASI_Rn01_00070786 predicted 759
10 SASI_Rn02_00260860 predicted 586
11 SASI_Rn01_00070777 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034326 predicted 781
2 SASI_Mm01_00034328 predicted 223
3 SASI_Mm01_00034329 predicted 827
4 SASI_Mm01_00034330 predicted 518
5 SASI_Mm01_00034331 predicted 533
6 SASI_Mm01_00034332 predicted 492
7 SASI_Mm01_00034333 predicted 769
8 SASI_Mm01_00034334 predicted 776
9 SASI_Mm02_00319336 predicted 389
10 SASI_Mm01_00034335 predicted 820
11 SASI_Mm01_00034327 predicted 807
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001836
CMA1 MISSION shRNA Bacterial Glycerol Stock
chymase 1, mast cell
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001836.x-311s1c1
Sequence:CCGGTAAAGCAATTCCGTCATCCAACTCGAGTTGGATGACGGAATTGCTTTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001836.x-341s1c1
Sequence:CCGGCTTCTACTCTTCACCACGATACTCGAGTATCGTGGTGAAGAGTAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001836.x-553s1c1
Sequence:CCGGTGCAGCCACTTCAGAGACTTTCTCGAGAAAGTCTCTGAAGTGGCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001836.x-262s1c1
Sequence:CCGGGCCCATAACATAACAGAGGAACTCGAGTTCCTCTGTTATGTTATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001836.x-231s1c1
Sequence:CCGGTGCAGGAAGGTCTATAACAGTCTCGAGACTGTTATAGACCTTCCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001836.2-180s21c1
Sequence:CCGGTTGTGGTGGTTTCCTTATAAGCTCGAGCTTATAAGGAAACCACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001836.2-133s21c1
Sequence:CCGGTACATGGCCTACCTGGAAATTCTCGAGAATTTCCAGGTAGGCCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001836.2-422s21c1
Sequence:CCGGTCCCATCACAATTCAACTTTGCTCGAGCAAAGTTGAATTGTGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001836
CMA1 MISSION shRNA shRNA Plasmid DNA
chymase 1, mast cell
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001836.x-311s1c1
Sequence:CCGGTAAAGCAATTCCGTCATCCAACTCGAGTTGGATGACGGAATTGCTTTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001836.x-341s1c1
Sequence:CCGGCTTCTACTCTTCACCACGATACTCGAGTATCGTGGTGAAGAGTAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001836.x-553s1c1
Sequence:CCGGTGCAGCCACTTCAGAGACTTTCTCGAGAAAGTCTCTGAAGTGGCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001836.x-262s1c1
Sequence:CCGGGCCCATAACATAACAGAGGAACTCGAGTTCCTCTGTTATGTTATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001836.x-231s1c1
Sequence:CCGGTGCAGGAAGGTCTATAACAGTCTCGAGACTGTTATAGACCTTCCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001836.2-180s21c1
Sequence:CCGGTTGTGGTGGTTTCCTTATAAGCTCGAGCTTATAAGGAAACCACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001836.2-133s21c1
Sequence:CCGGTACATGGCCTACCTGGAAATTCTCGAGAATTTCCAGGTAGGCCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001836.2-422s21c1
Sequence:CCGGTCCCATCACAATTCAACTTTGCTCGAGCAAAGTTGAATTGTGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001836
CMA1 MISSION shRNA Lentiviral Transduction Particles
chymase 1, mast cell
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001836.x-311s1c1
Sequence:CCGGTAAAGCAATTCCGTCATCCAACTCGAGTTGGATGACGGAATTGCTTTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001836.x-341s1c1
Sequence:CCGGCTTCTACTCTTCACCACGATACTCGAGTATCGTGGTGAAGAGTAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001836.x-553s1c1
Sequence:CCGGTGCAGCCACTTCAGAGACTTTCTCGAGAAAGTCTCTGAAGTGGCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001836.x-262s1c1
Sequence:CCGGGCCCATAACATAACAGAGGAACTCGAGTTCCTCTGTTATGTTATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001836.x-231s1c1
Sequence:CCGGTGCAGGAAGGTCTATAACAGTCTCGAGACTGTTATAGACCTTCCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001836.2-180s21c1
Sequence:CCGGTTGTGGTGGTTTCCTTATAAGCTCGAGCTTATAAGGAAACCACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001836.2-133s21c1
Sequence:CCGGTACATGGCCTACCTGGAAATTCTCGAGAATTTCCAGGTAGGCCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001836.2-422s21c1
Sequence:CCGGTCCCATCACAATTCAACTTTGCTCGAGCAAAGTTGAATTGTGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010780
CMA1 MISSION shRNA Bacterial Glycerol Stock
chymase 1, mast cell
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010780.1-779s1c1
Sequence:CCGGGCATCCTATGTACATCGGAATCTCGAGATTCCGATGTACATAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010780.1-616s1c1
Sequence:CCGGGCAGGAAGTAAAGATGAGACTCTCGAGAGTCTCATCTTTACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010780.1-841s1c1
Sequence:CCGGGCCCTGGATCAATAAGATCTTCTCGAGAAGATCTTATTGATCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010780.1-523s1c1
Sequence:CCGGCTCTGCCAACTTCAACTTTATCTCGAGATAAAGTTGAAGTTGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010780.1-282s1c1
Sequence:CCGGGCAGTGGCTTCCTGATAAGAACTCGAGTTCTTATCAGGAAGCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010780
CMA1 MISSION shRNA shRNA Plasmid DNA
chymase 1, mast cell
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010780.1-779s1c1
Sequence:CCGGGCATCCTATGTACATCGGAATCTCGAGATTCCGATGTACATAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010780.1-616s1c1
Sequence:CCGGGCAGGAAGTAAAGATGAGACTCTCGAGAGTCTCATCTTTACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010780.1-841s1c1
Sequence:CCGGGCCCTGGATCAATAAGATCTTCTCGAGAAGATCTTATTGATCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010780.1-523s1c1
Sequence:CCGGCTCTGCCAACTTCAACTTTATCTCGAGATAAAGTTGAAGTTGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010780.1-282s1c1
Sequence:CCGGGCAGTGGCTTCCTGATAAGAACTCGAGTTCTTATCAGGAAGCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010780
CMA1 MISSION shRNA Lentiviral Transduction Particles
chymase 1, mast cell
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010780.1-779s1c1
Sequence:CCGGGCATCCTATGTACATCGGAATCTCGAGATTCCGATGTACATAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010780.1-616s1c1
Sequence:CCGGGCAGGAAGTAAAGATGAGACTCTCGAGAGTCTCATCTTTACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010780.1-841s1c1
Sequence:CCGGGCCCTGGATCAATAAGATCTTCTCGAGAAGATCTTATTGATCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010780.1-523s1c1
Sequence:CCGGCTCTGCCAACTTCAACTTTATCTCGAGATAAAGTTGAAGTTGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010780.1-282s1c1
Sequence:CCGGGCAGTGGCTTCCTGATAAGAACTCGAGTTCTTATCAGGAAGCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks