EMAIL THIS PAGE TO A FRIEND

CMAS

cytidine monophosphate N-acetylneuraminic acid synthetase

69 Gene Product Result for
Synonyms: CSS
UniProtKB ID: Q8NFW8, Q96AX5, Q9NQZ0
Gene ID:
Human(55907) Summary: Sialic acids are a family of nine-carbon sugars on cell surface glycoproteins and glycolipids that play a pivotal role in determining the structure and function of many animal tissues. The pattern of cell surface sialylation is highly regulated during embryonic development and N-glycosylation is a common post-translational modification during cellular differentiation. Sialic acids play important roles in cell-cell communications and immune responses. Sialylated glycoprotein and glycolipid formation requires the activation of a sialic acid to a cytidine monophosphate (CMP) diester by the enzyme encoded by this gene: CMP-N-acetylneuraminic acid synthetase. [provided by RefSeq, Jul 2012]
Mouse(12764) cytidine monophospho-N-acetylneuraminic acid synthetase
Rat(312826) cytidine monophosphate N-acetylneuraminic acid synthetase
chicken(418199) cytidine monophosphate N-acetylneuraminic acid synthetase
cow(100336710) cytidine monophosphate N-acetylneuraminic acid synthetase
domestic cat(101096901) cytidine monophosphate N-acetylneuraminic acid synthetase
dog(477673) cytidine monophosphate N-acetylneuraminic acid synthetase
domestic guinea pig(100715137) cytidine monophosphate N-acetylneuraminic acid synthetase
naked mole-rat(101697716) cytidine monophosphate N-acetylneuraminic acid synthetase
sheep(101115615) cytidine monophosphate N-acetylneuraminic acid synthetase
Domestic Rabbit(100351910) cytidine monophosphate N-acetylneuraminic acid synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018686 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009908 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009908 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009908 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018686 Rosetta Predictions human pricing
NM_001009419 Rosetta Predictions rat pricing
NM_009908 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109065 predicted 1207
2 SASI_Hs01_00109066 predicted 792
3 SASI_Hs01_00109067 predicted 847
4 SASI_Hs01_00109068 predicted 938
5 SASI_Hs02_00352199 predicted 1007
6 SASI_Hs01_00109069 predicted 1104
7 SASI_Hs01_00109070 predicted 997
8 SASI_Hs01_00109071 predicted 833
9 SASI_Hs01_00109072 predicted 824
10 SASI_Hs01_00109073 predicted 641
11 SASI_Hs01_00109074 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087051 predicted 949
2 SASI_Rn01_00087052 predicted 372
3 SASI_Rn01_00087053 predicted 1360
4 SASI_Rn01_00087054 predicted 357
5 SASI_Rn01_00087055 predicted 703
6 SASI_Rn01_00087056 predicted 1395
7 SASI_Rn02_00199531 predicted 320
8 SASI_Rn01_00087057 predicted 915
9 SASI_Rn01_00087058 predicted 424
10 SASI_Rn01_00087060 predicted 1102
11 SASI_Rn01_00087059 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183051 predicted 920
2 SASI_Mm01_00183052 predicted 350
3 SASI_Mm01_00183053 predicted 532
4 SASI_Mm01_00183054 predicted 1096
5 SASI_Mm01_00183055 predicted 260
6 SASI_Mm01_00183056 predicted 1103
7 SASI_Mm01_00183057 predicted 335
8 SASI_Mm01_00183058 predicted 270
9 SASI_Mm01_00183059 predicted 1020
10 SASI_Mm01_00183060 predicted 312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018686
VALIDATED
CMAS MISSION shRNA Bacterial Glycerol Stock
cytidine monophosphate N-acetylneuraminic acid synthetase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018686.3-934s21c1
Sequence:CCGGTCTCACCAATGGCCACATTTACTCGAGTAAATGTGGCCATTGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018686.3-474s21c1
Sequence:CCGGATCATAATGAGGTTGACATTGCTCGAGCAATGTCAACCTCATTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018686.3-803s21c1
Sequence:CCGGGCTGAACATAGTGTGGATATACTCGAGTATATCCACACTATGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018686.3-1485s21c1
Sequence:CCGGGTGATTTGGTTTGTGATATATCTCGAGATATATCACAAACCAAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018686.3-827s21c1
Sequence:CCGGGTGGATATTGATTGGCCTATTCTCGAGAATAGGCCAATCAATATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018686.3-349s21c1
Sequence:CCGGTTCGACAGACCATGATGAAATCTCGAGATTTCATCATGGTCTGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018686.3-998s21c1
Sequence:CCGGGATGCTATTGGGATAAGTTTACTCGAGTAAACTTATCCCAATAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018686.3-551s1c1
Sequence:CCGGGCAGAAATGATTCGAGAAGAACTCGAGTTCTTCTCGAATCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018686.3-1331s1c1
Sequence:CCGGGCAGAGCACATTTGCCTACTACTCGAGTAGTAGGCAAATGTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018686.3-380s1c1
Sequence:CCGGGCCAAACAATTTGGTGCACAACTCGAGTTGTGCACCAAATTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018686.3-1277s1c1
Sequence:CCGGGCTGTTGGATACATTTGCAAACTCGAGTTTGCAAATGTATCCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018686.3-803s1c1
Sequence:CCGGGCTGAACATAGTGTGGATATACTCGAGTATATCCACACTATGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018686
VALIDATED
CMAS MISSION shRNA shRNA Plasmid DNA
cytidine monophosphate N-acetylneuraminic acid synthetase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018686.3-934s21c1
Sequence:CCGGTCTCACCAATGGCCACATTTACTCGAGTAAATGTGGCCATTGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018686.3-474s21c1
Sequence:CCGGATCATAATGAGGTTGACATTGCTCGAGCAATGTCAACCTCATTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018686.3-803s21c1
Sequence:CCGGGCTGAACATAGTGTGGATATACTCGAGTATATCCACACTATGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018686.3-1485s21c1
Sequence:CCGGGTGATTTGGTTTGTGATATATCTCGAGATATATCACAAACCAAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018686.3-827s21c1
Sequence:CCGGGTGGATATTGATTGGCCTATTCTCGAGAATAGGCCAATCAATATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018686.3-349s21c1
Sequence:CCGGTTCGACAGACCATGATGAAATCTCGAGATTTCATCATGGTCTGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018686.3-998s21c1
Sequence:CCGGGATGCTATTGGGATAAGTTTACTCGAGTAAACTTATCCCAATAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018686.3-551s1c1
Sequence:CCGGGCAGAAATGATTCGAGAAGAACTCGAGTTCTTCTCGAATCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018686.3-1331s1c1
Sequence:CCGGGCAGAGCACATTTGCCTACTACTCGAGTAGTAGGCAAATGTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018686.3-380s1c1
Sequence:CCGGGCCAAACAATTTGGTGCACAACTCGAGTTGTGCACCAAATTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018686.3-1277s1c1
Sequence:CCGGGCTGTTGGATACATTTGCAAACTCGAGTTTGCAAATGTATCCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018686.3-803s1c1
Sequence:CCGGGCTGAACATAGTGTGGATATACTCGAGTATATCCACACTATGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018686
VALIDATED
CMAS MISSION shRNA Lentiviral Transduction Particles
cytidine monophosphate N-acetylneuraminic acid synthetase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018686.3-934s21c1
Sequence:CCGGTCTCACCAATGGCCACATTTACTCGAGTAAATGTGGCCATTGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018686.3-474s21c1
Sequence:CCGGATCATAATGAGGTTGACATTGCTCGAGCAATGTCAACCTCATTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018686.3-803s21c1
Sequence:CCGGGCTGAACATAGTGTGGATATACTCGAGTATATCCACACTATGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018686.3-1485s21c1
Sequence:CCGGGTGATTTGGTTTGTGATATATCTCGAGATATATCACAAACCAAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018686.3-827s21c1
Sequence:CCGGGTGGATATTGATTGGCCTATTCTCGAGAATAGGCCAATCAATATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018686.3-349s21c1
Sequence:CCGGTTCGACAGACCATGATGAAATCTCGAGATTTCATCATGGTCTGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018686.3-998s21c1
Sequence:CCGGGATGCTATTGGGATAAGTTTACTCGAGTAAACTTATCCCAATAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018686.3-551s1c1
Sequence:CCGGGCAGAAATGATTCGAGAAGAACTCGAGTTCTTCTCGAATCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018686.3-1331s1c1
Sequence:CCGGGCAGAGCACATTTGCCTACTACTCGAGTAGTAGGCAAATGTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018686.3-380s1c1
Sequence:CCGGGCCAAACAATTTGGTGCACAACTCGAGTTGTGCACCAAATTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018686.3-1277s1c1
Sequence:CCGGGCTGTTGGATACATTTGCAAACTCGAGTTTGCAAATGTATCCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018686.3-803s1c1
Sequence:CCGGGCTGAACATAGTGTGGATATACTCGAGTATATCCACACTATGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009908
VALIDATED
CMAS MISSION shRNA Bacterial Glycerol Stock
cytidine monophosphate N-acetylneuraminic acid synthetase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009908.1-1494s21c1
Sequence:CCGGCGAGGTAATTACCGAGGGATTCTCGAGAATCCCTCGGTAATTACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009908.1-1000s21c1
Sequence:CCGGGCCCTAAAGCTGGACTGTAAACTCGAGTTTACAGTCCAGCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009908.1-456s21c1
Sequence:CCGGCCAGAAAGTTGCAGAAATGATCTCGAGATCATTTCTGCAACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009908.1-420s21c1
Sequence:CCGGCCAAGCCACATCTCCATGTTTCTCGAGAAACATGGAGATGTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009908.1-1494s1c1
Sequence:CCGGCGAGGTAATTACCGAGGGATTCTCGAGAATCCCTCGGTAATTACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009908.1-1000s1c1
Sequence:CCGGGCCCTAAAGCTGGACTGTAAACTCGAGTTTACAGTCCAGCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009908.1-574s1c1
Sequence:CCGGCTGAACTTGAATCCAGCGAAACTCGAGTTTCGCTGGATTCAAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009908.1-456s1c1
Sequence:CCGGCCAGAAAGTTGCAGAAATGATCTCGAGATCATTTCTGCAACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009908.1-420s1c1
Sequence:CCGGCCAAGCCACATCTCCATGTTTCTCGAGAAACATGGAGATGTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009908
VALIDATED
CMAS MISSION shRNA shRNA Plasmid DNA
cytidine monophosphate N-acetylneuraminic acid synthetase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009908.1-1494s21c1
Sequence:CCGGCGAGGTAATTACCGAGGGATTCTCGAGAATCCCTCGGTAATTACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009908.1-1000s21c1
Sequence:CCGGGCCCTAAAGCTGGACTGTAAACTCGAGTTTACAGTCCAGCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009908.1-456s21c1
Sequence:CCGGCCAGAAAGTTGCAGAAATGATCTCGAGATCATTTCTGCAACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009908.1-420s21c1
Sequence:CCGGCCAAGCCACATCTCCATGTTTCTCGAGAAACATGGAGATGTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009908.1-1494s1c1
Sequence:CCGGCGAGGTAATTACCGAGGGATTCTCGAGAATCCCTCGGTAATTACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009908.1-1000s1c1
Sequence:CCGGGCCCTAAAGCTGGACTGTAAACTCGAGTTTACAGTCCAGCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009908.1-574s1c1
Sequence:CCGGCTGAACTTGAATCCAGCGAAACTCGAGTTTCGCTGGATTCAAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009908.1-456s1c1
Sequence:CCGGCCAGAAAGTTGCAGAAATGATCTCGAGATCATTTCTGCAACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009908.1-420s1c1
Sequence:CCGGCCAAGCCACATCTCCATGTTTCTCGAGAAACATGGAGATGTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009908
VALIDATED
CMAS MISSION shRNA Lentiviral Transduction Particles
cytidine monophosphate N-acetylneuraminic acid synthetase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009908.1-1494s21c1
Sequence:CCGGCGAGGTAATTACCGAGGGATTCTCGAGAATCCCTCGGTAATTACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009908.1-1000s21c1
Sequence:CCGGGCCCTAAAGCTGGACTGTAAACTCGAGTTTACAGTCCAGCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009908.1-456s21c1
Sequence:CCGGCCAGAAAGTTGCAGAAATGATCTCGAGATCATTTCTGCAACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009908.1-420s21c1
Sequence:CCGGCCAAGCCACATCTCCATGTTTCTCGAGAAACATGGAGATGTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009908.1-1494s1c1
Sequence:CCGGCGAGGTAATTACCGAGGGATTCTCGAGAATCCCTCGGTAATTACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009908.1-1000s1c1
Sequence:CCGGGCCCTAAAGCTGGACTGTAAACTCGAGTTTACAGTCCAGCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009908.1-574s1c1
Sequence:CCGGCTGAACTTGAATCCAGCGAAACTCGAGTTTCGCTGGATTCAAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009908.1-456s1c1
Sequence:CCGGCCAGAAAGTTGCAGAAATGATCTCGAGATCATTTCTGCAACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009908.1-420s1c1
Sequence:CCGGCCAAGCCACATCTCCATGTTTCTCGAGAAACATGGAGATGTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks