EMAIL THIS PAGE TO A FRIEND

CMBL

carboxymethylenebutenolidase homolog (Pseudomonas)

57 Gene Product Result for
Synonyms: JS-1
UniProtKB ID: Q96DG6, D3DTC7, Q8TED6
Gene ID:
Human(134147) Summary: CMBL (EC 3.1.1.45) is a cysteine hydrolase of the dienelactone hydrolase family that is highly expressed in liver cytosol. CMBL preferentially cleaves cyclic esters, and it activates medoxomil-ester prodrugs in which the medoxomil moiety is linked to an oxygen atom (Ishizuka et al., 2010 [PubMed 20177059]
Mouse(69574) carboxymethylenebutenolidase-like (Pseudomonas)
Rat(310201) carboxymethylenebutenolidase homolog (Pseudomonas)
Zebrafish(100151256) carboxymethylenebutenolidase-like (Pseudomonas)
chicken(420928) carboxymethylenebutenolidase homolog (Pseudomonas)
domestic cat(101093165) carboxymethylenebutenolidase homolog (Pseudomonas)
cow(516405) carboxymethylenebutenolidase homolog (Pseudomonas)
dog(478619) carboxymethylenebutenolidase homolog (Pseudomonas)
sheep(101121802) carboxymethylenebutenolidase homolog (Pseudomonas)
naked mole-rat(101723921) carboxymethylenebutenolidase homolog (Pseudomonas)
domestic guinea pig(100733675) carboxymethylenebutenolidase homolog (Pseudomonas)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138809 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138809 Rosetta Predictions human pricing
NM_001008770 Rosetta Predictions rat pricing
NM_181588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121276 predicted 637
2 SASI_Hs01_00121277 predicted 779
3 SASI_Hs01_00121278 predicted 863
4 SASI_Hs01_00121279 predicted 781
5 SASI_Hs01_00121280 predicted 916
6 SASI_Hs01_00121281 predicted 1026
7 SASI_Hs01_00121282 predicted 934
8 SASI_Hs01_00121284 predicted 623
9 SASI_Hs02_00363968 predicted 1006
10 SASI_Hs02_00363969 predicted 994
11 SASI_Hs01_00121283 predicted 1042
12 SASI_Hs01_00121285 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097391 predicted 507
2 SASI_Rn01_00097392 predicted 865
3 SASI_Rn01_00097393 predicted 607
4 SASI_Rn01_00097394 predicted 217
5 SASI_Rn01_00097395 predicted 262
6 SASI_Rn01_00097398 predicted 873
7 SASI_Rn01_00097399 predicted 244
8 SASI_Rn01_00097400 predicted 583
9 SASI_Rn02_00199288 predicted 226
10 SASI_Rn02_00199289 predicted 322
11 SASI_Rn01_00097396 predicted 829
12 SASI_Rn01_00097397 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181724 predicted 218
2 SASI_Mm02_00349850 predicted 373
3 SASI_Mm02_00349851 predicted 741
4 SASI_Mm02_00349852 predicted 213
5 SASI_Mm02_00349853 predicted 679
6 SASI_Mm02_00349854 predicted 425
7 SASI_Mm02_00349855 predicted 521
8 SASI_Mm02_00349856 predicted 357
9 SASI_Mm02_00349857 predicted 728
10 SASI_Mm01_00181727 predicted 242
11 SASI_Mm01_00181725 predicted 844
12 SASI_Mm01_00181726 predicted 199
13 SASI_Mm01_00181728 predicted 281
14 SASI_Mm01_00181729 predicted 476
15 SASI_Mm01_00181730 predicted 612
16 SASI_Mm01_00181731 predicted 741
17 SASI_Mm01_00181732 predicted 668
18 SASI_Mm01_00181733 predicted 775
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138809
CMBL MISSION shRNA Bacterial Glycerol Stock
carboxymethylenebutenolidase homolog (Pseudomonas)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138809.2-470s1c1
Sequence:CCGGCCAGACTTCTTTGTAGGGCAACTCGAGTTGCCCTACAAAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138809.2-833s1c1
Sequence:CCGGCACTGCAAAGTTGAATATCAACTCGAGTTGATATTCAACTTTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138809.2-949s1c1
Sequence:CCGGGAATTTAATTGAGTGGCTGAACTCGAGTTCAGCCACTCAATTAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138809.2-323s1c1
Sequence:CCGGGTCGAGCACATCAAGGCTTATCTCGAGATAAGCCTTGATGTGCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138809.2-802s1c1
Sequence:CCGGCGTATCTTTGCTGACTCAGAACTCGAGTTCTGAGTCAGCAAAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138809.3-1367s21c1
Sequence:CCGGGACATGTACATCGAATCATAACTCGAGTTATGATTCGATGTACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138809.3-853s21c1
Sequence:CCGGTGGAACTGCTGTCCATCATTTCTCGAGAAATGATGGACAGCAGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138809.3-1325s21c1
Sequence:CCGGACAAATTCAGTAGGACGTAATCTCGAGATTACGTCCTACTGAATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138809.3-615s21c1
Sequence:CCGGAGTTGCCCAATACCAGATATACTCGAGTATATCTGGTATTGGGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138809.3-584s21c1
Sequence:CCGGGTGATTGTCATTCAAGATATACTCGAGTATATCTTGAATGACAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138809
CMBL MISSION shRNA shRNA Plasmid DNA
carboxymethylenebutenolidase homolog (Pseudomonas)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138809.2-470s1c1
Sequence:CCGGCCAGACTTCTTTGTAGGGCAACTCGAGTTGCCCTACAAAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138809.2-833s1c1
Sequence:CCGGCACTGCAAAGTTGAATATCAACTCGAGTTGATATTCAACTTTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138809.2-949s1c1
Sequence:CCGGGAATTTAATTGAGTGGCTGAACTCGAGTTCAGCCACTCAATTAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138809.2-323s1c1
Sequence:CCGGGTCGAGCACATCAAGGCTTATCTCGAGATAAGCCTTGATGTGCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138809.2-802s1c1
Sequence:CCGGCGTATCTTTGCTGACTCAGAACTCGAGTTCTGAGTCAGCAAAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138809.3-1367s21c1
Sequence:CCGGGACATGTACATCGAATCATAACTCGAGTTATGATTCGATGTACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138809.3-853s21c1
Sequence:CCGGTGGAACTGCTGTCCATCATTTCTCGAGAAATGATGGACAGCAGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138809.3-1325s21c1
Sequence:CCGGACAAATTCAGTAGGACGTAATCTCGAGATTACGTCCTACTGAATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138809.3-615s21c1
Sequence:CCGGAGTTGCCCAATACCAGATATACTCGAGTATATCTGGTATTGGGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138809.3-584s21c1
Sequence:CCGGGTGATTGTCATTCAAGATATACTCGAGTATATCTTGAATGACAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138809
CMBL MISSION shRNA Lentiviral Transduction Particles
carboxymethylenebutenolidase homolog (Pseudomonas)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138809.2-470s1c1
Sequence:CCGGCCAGACTTCTTTGTAGGGCAACTCGAGTTGCCCTACAAAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138809.2-833s1c1
Sequence:CCGGCACTGCAAAGTTGAATATCAACTCGAGTTGATATTCAACTTTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138809.2-949s1c1
Sequence:CCGGGAATTTAATTGAGTGGCTGAACTCGAGTTCAGCCACTCAATTAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138809.2-323s1c1
Sequence:CCGGGTCGAGCACATCAAGGCTTATCTCGAGATAAGCCTTGATGTGCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138809.2-802s1c1
Sequence:CCGGCGTATCTTTGCTGACTCAGAACTCGAGTTCTGAGTCAGCAAAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138809.3-1367s21c1
Sequence:CCGGGACATGTACATCGAATCATAACTCGAGTTATGATTCGATGTACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138809.3-853s21c1
Sequence:CCGGTGGAACTGCTGTCCATCATTTCTCGAGAAATGATGGACAGCAGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138809.3-1325s21c1
Sequence:CCGGACAAATTCAGTAGGACGTAATCTCGAGATTACGTCCTACTGAATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138809.3-615s21c1
Sequence:CCGGAGTTGCCCAATACCAGATATACTCGAGTATATCTGGTATTGGGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138809.3-584s21c1
Sequence:CCGGGTGATTGTCATTCAAGATATACTCGAGTATATCTTGAATGACAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181588
VALIDATED
CMBL MISSION shRNA Bacterial Glycerol Stock
carboxymethylenebutenolidase homolog (Pseudomonas)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201288    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181588.2-836s1c1
Sequence:CCGGGCCCAAATTTGCCTGAATAATCTCGAGATTATTCAGGCAAATTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181588.2-779s1c1
Sequence:CCGGCCTAATTGAATGGCTGAACAACTCGAGTTGTTCAGCCATTCAATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181588.2-776s1c1
Sequence:CCGGGAACCTAATTGAATGGCTGAACTCGAGTTCAGCCATTCAATTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181588.3-547s21c1
Sequence:CCGGTGAAGAACCCAACGTTGTTTACTCGAGTAAACAACGTTGGGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181588.3-810s21c1
Sequence:CCGGTTGCCCAAATTTGCCTGAATACTCGAGTATTCAGGCAAATTTGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181588.3-265s1c1
Sequence:CCGGCTATTGTCCCAGACTTCTTTGCTCGAGCAAAGAAGTCTGGGACAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181588.3-629s21c1
Sequence:CCGGTAAAGAACACTGCATAGTTAACTCGAGTTAACTATGCAGTGTTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181588.3-212s21c1
Sequence:CCGGGCTGCCCAACACCAGGTATATCTCGAGATATACCTGGTGTTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181588.3-166s21c1
Sequence:CCGGATGCAGGCAAAGCCGTGATTGCTCGAGCAATCACGGCTTTGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181588
VALIDATED
CMBL MISSION shRNA shRNA Plasmid DNA
carboxymethylenebutenolidase homolog (Pseudomonas)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201288    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181588.2-836s1c1
Sequence:CCGGGCCCAAATTTGCCTGAATAATCTCGAGATTATTCAGGCAAATTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181588.2-779s1c1
Sequence:CCGGCCTAATTGAATGGCTGAACAACTCGAGTTGTTCAGCCATTCAATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181588.2-776s1c1
Sequence:CCGGGAACCTAATTGAATGGCTGAACTCGAGTTCAGCCATTCAATTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181588.3-547s21c1
Sequence:CCGGTGAAGAACCCAACGTTGTTTACTCGAGTAAACAACGTTGGGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181588.3-810s21c1
Sequence:CCGGTTGCCCAAATTTGCCTGAATACTCGAGTATTCAGGCAAATTTGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181588.3-265s1c1
Sequence:CCGGCTATTGTCCCAGACTTCTTTGCTCGAGCAAAGAAGTCTGGGACAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181588.3-629s21c1
Sequence:CCGGTAAAGAACACTGCATAGTTAACTCGAGTTAACTATGCAGTGTTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181588.3-212s21c1
Sequence:CCGGGCTGCCCAACACCAGGTATATCTCGAGATATACCTGGTGTTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181588.3-166s21c1
Sequence:CCGGATGCAGGCAAAGCCGTGATTGCTCGAGCAATCACGGCTTTGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181588
VALIDATED
CMBL MISSION shRNA Lentiviral Transduction Particles
carboxymethylenebutenolidase homolog (Pseudomonas)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201288    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181588.2-836s1c1
Sequence:CCGGGCCCAAATTTGCCTGAATAATCTCGAGATTATTCAGGCAAATTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181588.2-779s1c1
Sequence:CCGGCCTAATTGAATGGCTGAACAACTCGAGTTGTTCAGCCATTCAATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181588.2-776s1c1
Sequence:CCGGGAACCTAATTGAATGGCTGAACTCGAGTTCAGCCATTCAATTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181588.3-547s21c1
Sequence:CCGGTGAAGAACCCAACGTTGTTTACTCGAGTAAACAACGTTGGGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181588.3-810s21c1
Sequence:CCGGTTGCCCAAATTTGCCTGAATACTCGAGTATTCAGGCAAATTTGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181588.3-265s1c1
Sequence:CCGGCTATTGTCCCAGACTTCTTTGCTCGAGCAAAGAAGTCTGGGACAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181588.3-629s21c1
Sequence:CCGGTAAAGAACACTGCATAGTTAACTCGAGTTAACTATGCAGTGTTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181588.3-212s21c1
Sequence:CCGGGCTGCCCAACACCAGGTATATCTCGAGATATACCTGGTGTTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181588.3-166s21c1
Sequence:CCGGATGCAGGCAAAGCCGTGATTGCTCGAGCAATCACGGCTTTGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks