EMAIL THIS PAGE TO A FRIEND

CMC1

COX assembly mitochondrial protein 1 homolog (S. cerevisiae)

55 Gene Product Result for
Synonyms: C3orf68
UniProtKB ID: Q7Z7K0, Q68DJ7
Gene ID:
Mouse(67899) COX assembly mitochondrial protein 1
Rat(363162) COX assembly mitochondrial protein 1
domestic guinea pig(100713438) COX assembly mitochondrial protein 1 homolog (S. cerevisiae)
naked mole-rat(101702589) COX assembly mitochondrial protein 1 homolog (S. cerevisiae)
Zebrafish(406630) COX assembly mitochondrial protein 1 homolog (S. cerevisiae)
chicken(420659) COX assembly mitochondrial protein 1 homolog (S. cerevisiae)
domestic cat(101088183) COX assembly mitochondrial protein 1 homolog (S. cerevisiae)
cow(767824) COX assembly mitochondrial protein homolog (S. cerevisiae)
dog(485633) COX assembly mitochondrial protein homolog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026442 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026442 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026442 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182523 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002411 MISSION® esiRNA esiRNA targeting human CMC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182523 Rosetta Predictions human pricing
XM_001077986 Rosetta Predictions rat pricing
XM_343501 Rosetta Predictions rat pricing
NM_026442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186165 predicted 234
2 SASI_Hs01_00186166 predicted 248
3 SASI_Hs01_00186167 predicted 295
4 SASI_Hs01_00186168 predicted 241
5 SASI_Hs01_00186169 predicted 240
6 SASI_Hs01_00186170 predicted 340
7 SASI_Hs01_00186171 predicted 240
8 SASI_Hs01_00186172 predicted 287
9 SASI_Hs01_00186173 predicted 356
10 SASI_Hs01_00186174 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359242 predicted 341
2 SASI_Rn02_00359243 predicted 196
3 SASI_Rn02_00359244 predicted 328
4 SASI_Rn02_00359245 predicted 340
5 SASI_Rn02_00359246 predicted 335
6 SASI_Rn02_00359247 predicted 284
7 SASI_Rn02_00359248 predicted 243
8 SASI_Rn02_00359249 predicted 280
9 SASI_Rn02_00359250 predicted 236
10 SASI_Rn02_00359251 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395904 predicted 340
2 SASI_Rn02_00395905 predicted 328
3 SASI_Rn02_00395906 predicted 348
4 SASI_Rn02_00395907 predicted 336
5 SASI_Rn02_00395908 predicted 293
6 SASI_Rn02_00395909 predicted 283
7 SASI_Rn02_00395910 predicted 286
8 SASI_Rn02_00395911 predicted 337
9 SASI_Rn02_00395912 predicted 286
10 SASI_Rn02_00395913 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065411 predicted 225
2 SASI_Mm01_00065412 predicted 217
3 SASI_Mm01_00065414 predicted 219
4 SASI_Mm01_00065415 predicted 225
5 SASI_Mm01_00065416 predicted 220
6 SASI_Mm01_00065417 predicted 262
7 SASI_Mm01_00065418 predicted 212
8 SASI_Mm02_00330273 predicted 199
9 SASI_Mm01_00065419 predicted 219
10 SASI_Mm01_00065420 predicted 228
11 SASI_Mm01_00065413 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026442
VALIDATED
CMC1 MISSION shRNA Bacterial Glycerol Stock
COX assembly mitochondrial protein 1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026442.2-73s1c1
Sequence:CCGGCTGAGACACGTCGAGAAAGATCTCGAGATCTTTCTCGACGTGTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026442.2-137s1c1
Sequence:CCGGGCTCCGAACAAGTTGAAGATTCTCGAGAATCTTCAACTTGTTCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026442.2-91s1c1
Sequence:CCGGGATGTTCTGATCCCAAAGATACTCGAGTATCTTTGGGATCAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026442.2-268s1c1
Sequence:CCGGGAAGAATGCAAACTGGAGTATCTCGAGATACTCCAGTTTGCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026442.2-87s1c1
Sequence:CCGGGAAAGATGTTCTGATCCCAAACTCGAGTTTGGGATCAGAACATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026442
VALIDATED
CMC1 MISSION shRNA shRNA Plasmid DNA
COX assembly mitochondrial protein 1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026442.2-73s1c1
Sequence:CCGGCTGAGACACGTCGAGAAAGATCTCGAGATCTTTCTCGACGTGTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026442.2-137s1c1
Sequence:CCGGGCTCCGAACAAGTTGAAGATTCTCGAGAATCTTCAACTTGTTCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026442.2-91s1c1
Sequence:CCGGGATGTTCTGATCCCAAAGATACTCGAGTATCTTTGGGATCAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026442.2-268s1c1
Sequence:CCGGGAAGAATGCAAACTGGAGTATCTCGAGATACTCCAGTTTGCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026442.2-87s1c1
Sequence:CCGGGAAAGATGTTCTGATCCCAAACTCGAGTTTGGGATCAGAACATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026442
VALIDATED
CMC1 MISSION shRNA Lentiviral Transduction Particles
COX assembly mitochondrial protein 1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026442.2-73s1c1
Sequence:CCGGCTGAGACACGTCGAGAAAGATCTCGAGATCTTTCTCGACGTGTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026442.2-137s1c1
Sequence:CCGGGCTCCGAACAAGTTGAAGATTCTCGAGAATCTTCAACTTGTTCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026442.2-91s1c1
Sequence:CCGGGATGTTCTGATCCCAAAGATACTCGAGTATCTTTGGGATCAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026442.2-268s1c1
Sequence:CCGGGAAGAATGCAAACTGGAGTATCTCGAGATACTCCAGTTTGCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026442.2-87s1c1
Sequence:CCGGGAAAGATGTTCTGATCCCAAACTCGAGTTTGGGATCAGAACATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182523
VALIDATED
CMC1 MISSION shRNA Bacterial Glycerol Stock
COX assembly mitochondrial protein 1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-242s1c1
Sequence:CCGGCAAAGAGAGGTGTTCTGAACACTCGAGTGTTCAGAACACCTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-461s1c1
Sequence:CCGGGAAGCTTCCAACAAGCATGTACTCGAGTACATGCTTGTTGGAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182523.1-358s1c1
Sequence:CCGGCTTACTATAATGATCCAGCCTCTCGAGAGGCTGGATCATTATAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182523.1-286s1c1
Sequence:CCGGGCAAGAACTCTGGAGTTCTTACTCGAGTAAGAACTCCAGAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-399s1c1
Sequence:CCGGGAATACCTGAAGGAAAGGGAACTCGAGTTCCCTTTCCTTCAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-287s1c1
Sequence:CCGGCAAGAACTCTGGAGTTCTTATCTCGAGATAAGAACTCCAGAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-251s1c1
Sequence:CCGGGTGTTCTGAACAAGTTCAAGACTCGAGTCTTGAACTTGTTCAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182523.1-349s1c1
Sequence:CCGGGTCTAACTGCTTACTATAATGCTCGAGCATTATAGTAAGCAGTTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-253s1c1
Sequence:CCGGGTTCTGAACAAGTTCAAGATTCTCGAGAATCTTGAACTTGTTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-345s1c1
Sequence:CCGGGAATGTCTAACTGCTTACTATCTCGAGATAGTAAGCAGTTAGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182523
VALIDATED
CMC1 MISSION shRNA shRNA Plasmid DNA
COX assembly mitochondrial protein 1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-242s1c1
Sequence:CCGGCAAAGAGAGGTGTTCTGAACACTCGAGTGTTCAGAACACCTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-461s1c1
Sequence:CCGGGAAGCTTCCAACAAGCATGTACTCGAGTACATGCTTGTTGGAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182523.1-358s1c1
Sequence:CCGGCTTACTATAATGATCCAGCCTCTCGAGAGGCTGGATCATTATAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182523.1-286s1c1
Sequence:CCGGGCAAGAACTCTGGAGTTCTTACTCGAGTAAGAACTCCAGAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-399s1c1
Sequence:CCGGGAATACCTGAAGGAAAGGGAACTCGAGTTCCCTTTCCTTCAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-287s1c1
Sequence:CCGGCAAGAACTCTGGAGTTCTTATCTCGAGATAAGAACTCCAGAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-251s1c1
Sequence:CCGGGTGTTCTGAACAAGTTCAAGACTCGAGTCTTGAACTTGTTCAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182523.1-349s1c1
Sequence:CCGGGTCTAACTGCTTACTATAATGCTCGAGCATTATAGTAAGCAGTTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-253s1c1
Sequence:CCGGGTTCTGAACAAGTTCAAGATTCTCGAGAATCTTGAACTTGTTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-345s1c1
Sequence:CCGGGAATGTCTAACTGCTTACTATCTCGAGATAGTAAGCAGTTAGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182523
VALIDATED
CMC1 MISSION shRNA Lentiviral Transduction Particles
COX assembly mitochondrial protein 1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-242s1c1
Sequence:CCGGCAAAGAGAGGTGTTCTGAACACTCGAGTGTTCAGAACACCTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-461s1c1
Sequence:CCGGGAAGCTTCCAACAAGCATGTACTCGAGTACATGCTTGTTGGAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182523.1-358s1c1
Sequence:CCGGCTTACTATAATGATCCAGCCTCTCGAGAGGCTGGATCATTATAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182523.1-286s1c1
Sequence:CCGGGCAAGAACTCTGGAGTTCTTACTCGAGTAAGAACTCCAGAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-399s1c1
Sequence:CCGGGAATACCTGAAGGAAAGGGAACTCGAGTTCCCTTTCCTTCAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-287s1c1
Sequence:CCGGCAAGAACTCTGGAGTTCTTATCTCGAGATAAGAACTCCAGAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-251s1c1
Sequence:CCGGGTGTTCTGAACAAGTTCAAGACTCGAGTCTTGAACTTGTTCAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182523.1-349s1c1
Sequence:CCGGGTCTAACTGCTTACTATAATGCTCGAGCATTATAGTAAGCAGTTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-253s1c1
Sequence:CCGGGTTCTGAACAAGTTCAAGATTCTCGAGAATCTTGAACTTGTTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182523.1-345s1c1
Sequence:CCGGGAATGTCTAACTGCTTACTATCTCGAGATAGTAAGCAGTTAGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks