EMAIL THIS PAGE TO A FRIEND

CMC2

COX assembly mitochondrial protein 2 homolog (S. cerevisiae)

62 Gene Product Result for
Synonyms: 2310061C15Rik C16orf61
UniProtKB ID: Q9NRP2, D3DUK6
Gene ID:
Mouse(66531) COX assembly mitochondrial protein 2
Rat(100363376) COX assembly mitochondrial protein 2
Zebrafish(368857) COX assembly mitochondrial protein 2 homolog (S. cerevisiae)
cow(614078) COX assembly mitochondrial protein 2 homolog (S. cerevisiae)
domestic cat(101100527) COX assembly mitochondrial protein 2 homolog (S. cerevisiae)
sheep(101120939) COX assembly mitochondrial protein 2 homolog (S. cerevisiae)
naked mole-rat(101725751) COX assembly mitochondrial protein 2 homolog (S. cerevisiae)
domestic guinea pig(100722592) COX assembly mitochondrial protein 2 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026844 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026844 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026844 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020188 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020188 Rosetta Predictions human pricing
NM_026844 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042622 predicted 382
2 SASI_Hs01_00042623 predicted 339
3 SASI_Hs01_00042624 predicted 475
4 SASI_Hs01_00042625 predicted 235
5 SASI_Hs01_00042626 predicted 449
6 SASI_Hs02_00353109 predicted 478
7 SASI_Hs02_00353110 predicted 494
8 SASI_Hs01_00042627 predicted 380
9 SASI_Hs01_00042629 predicted 226
10 SASI_Hs01_00042630 predicted 304
11 SASI_Hs01_00042628 predicted 257
12 SASI_Hs01_00042631 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331035 predicted 417
2 SASI_Mm02_00331036 predicted 578
3 SASI_Mm02_00331037 predicted 566
4 SASI_Mm02_00331038 predicted 416
5 SASI_Mm02_00331039 predicted 458
6 SASI_Mm01_00061194 predicted 221
7 SASI_Mm02_00331040 predicted 605
8 SASI_Mm02_00331041 predicted 388
9 SASI_Mm01_00061196 predicted 214
10 SASI_Mm02_00331042 predicted 479
11 SASI_Mm01_00061189 predicted 302
12 SASI_Mm01_00061190 predicted 367
13 SASI_Mm01_00061191 predicted 383
14 SASI_Mm01_00061192 predicted 312
15 SASI_Mm01_00061193 predicted 389
16 SASI_Mm01_00061195 predicted 385
17 SASI_Mm01_00061197 predicted 359
18 SASI_Mm01_00061198 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026844
VALIDATED
CMC2 MISSION shRNA Bacterial Glycerol Stock
COX assembly mitochondrial protein 2 homolog (S. cerevisiae)
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026844.2-446s1c1
Sequence:CCGGGCTCTGAAGAACGGAACCATACTCGAGTATGGTTCCGTTCTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026844.2-451s1c1
Sequence:CCGGGAAGAACGGAACCATAGGGAACTCGAGTTCCCTATGGTTCCGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026844.2-395s1c1
Sequence:CCGGGCCGAAGAATATCCTTTCTTACTCGAGTAAGAAAGGATATTCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026844.2-169s1c1
Sequence:CCGGCCTGCTAAAGGAATGTCACAACTCGAGTTGTGACATTCCTTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026844.2-145s1c1
Sequence:CCGGCGAAGAATGCAACGTCCTGATCTCGAGATCAGGACGTTGCATTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026844.2-146s1c1
Sequence:CCGGGAAGAATGCAACGTCCTGATTCTCGAGAATCAGGACGTTGCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026844.3-236s21c1
Sequence:CCGGCGGGAAATGAGGAAGTGTTTGCTCGAGCAAACACTTCCTCATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026844.3-915s1c1
Sequence:CCGGCACAGCACAGCTATCACTTTACTCGAGTAAAGTGATAGCTGTGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026844.3-169s21c1
Sequence:CCGGCCTGCTAAAGGAATGTCACAACTCGAGTTGTGACATTCCTTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026844.3-144s21c1
Sequence:CCGGCCGAAGAATGCAACGTCCTGACTCGAGTCAGGACGTTGCATTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026844.3-395s21c1
Sequence:CCGGGCCGAAGAATATCCTTTCTTACTCGAGTAAGAAAGGATATTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026844.3-446s21c1
Sequence:CCGGGCTCTGAAGAACGGAACCATACTCGAGTATGGTTCCGTTCTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026844.3-211s21c1
Sequence:CCGGTTTCGGCCATTGCAACGACCTCTCGAGAGGTCGTTGCAATGGCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026844.3-331s21c1
Sequence:CCGGTCCAGAGGAAGCTGGGAGATACTCGAGTATCTCCCAGCTTCCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026844
VALIDATED
CMC2 MISSION shRNA shRNA Plasmid DNA
COX assembly mitochondrial protein 2 homolog (S. cerevisiae)
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026844.2-446s1c1
Sequence:CCGGGCTCTGAAGAACGGAACCATACTCGAGTATGGTTCCGTTCTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026844.2-451s1c1
Sequence:CCGGGAAGAACGGAACCATAGGGAACTCGAGTTCCCTATGGTTCCGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026844.2-395s1c1
Sequence:CCGGGCCGAAGAATATCCTTTCTTACTCGAGTAAGAAAGGATATTCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026844.2-169s1c1
Sequence:CCGGCCTGCTAAAGGAATGTCACAACTCGAGTTGTGACATTCCTTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026844.2-145s1c1
Sequence:CCGGCGAAGAATGCAACGTCCTGATCTCGAGATCAGGACGTTGCATTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026844.2-146s1c1
Sequence:CCGGGAAGAATGCAACGTCCTGATTCTCGAGAATCAGGACGTTGCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026844.3-236s21c1
Sequence:CCGGCGGGAAATGAGGAAGTGTTTGCTCGAGCAAACACTTCCTCATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026844.3-915s1c1
Sequence:CCGGCACAGCACAGCTATCACTTTACTCGAGTAAAGTGATAGCTGTGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026844.3-169s21c1
Sequence:CCGGCCTGCTAAAGGAATGTCACAACTCGAGTTGTGACATTCCTTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026844.3-144s21c1
Sequence:CCGGCCGAAGAATGCAACGTCCTGACTCGAGTCAGGACGTTGCATTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026844.3-395s21c1
Sequence:CCGGGCCGAAGAATATCCTTTCTTACTCGAGTAAGAAAGGATATTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026844.3-446s21c1
Sequence:CCGGGCTCTGAAGAACGGAACCATACTCGAGTATGGTTCCGTTCTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026844.3-211s21c1
Sequence:CCGGTTTCGGCCATTGCAACGACCTCTCGAGAGGTCGTTGCAATGGCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026844.3-331s21c1
Sequence:CCGGTCCAGAGGAAGCTGGGAGATACTCGAGTATCTCCCAGCTTCCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026844
VALIDATED
CMC2 MISSION shRNA Lentiviral Transduction Particles
COX assembly mitochondrial protein 2 homolog (S. cerevisiae)
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026844.2-446s1c1
Sequence:CCGGGCTCTGAAGAACGGAACCATACTCGAGTATGGTTCCGTTCTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026844.2-451s1c1
Sequence:CCGGGAAGAACGGAACCATAGGGAACTCGAGTTCCCTATGGTTCCGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026844.2-395s1c1
Sequence:CCGGGCCGAAGAATATCCTTTCTTACTCGAGTAAGAAAGGATATTCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026844.2-169s1c1
Sequence:CCGGCCTGCTAAAGGAATGTCACAACTCGAGTTGTGACATTCCTTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026844.2-145s1c1
Sequence:CCGGCGAAGAATGCAACGTCCTGATCTCGAGATCAGGACGTTGCATTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026844.2-146s1c1
Sequence:CCGGGAAGAATGCAACGTCCTGATTCTCGAGAATCAGGACGTTGCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026844.3-236s21c1
Sequence:CCGGCGGGAAATGAGGAAGTGTTTGCTCGAGCAAACACTTCCTCATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026844.3-915s1c1
Sequence:CCGGCACAGCACAGCTATCACTTTACTCGAGTAAAGTGATAGCTGTGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026844.3-169s21c1
Sequence:CCGGCCTGCTAAAGGAATGTCACAACTCGAGTTGTGACATTCCTTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026844.3-144s21c1
Sequence:CCGGCCGAAGAATGCAACGTCCTGACTCGAGTCAGGACGTTGCATTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026844.3-395s21c1
Sequence:CCGGGCCGAAGAATATCCTTTCTTACTCGAGTAAGAAAGGATATTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026844.3-446s21c1
Sequence:CCGGGCTCTGAAGAACGGAACCATACTCGAGTATGGTTCCGTTCTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026844.3-211s21c1
Sequence:CCGGTTTCGGCCATTGCAACGACCTCTCGAGAGGTCGTTGCAATGGCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026844.3-331s21c1
Sequence:CCGGTCCAGAGGAAGCTGGGAGATACTCGAGTATCTCCCAGCTTCCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020188
VALIDATED
CMC2 MISSION shRNA Bacterial Glycerol Stock
COX assembly mitochondrial protein 2 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020188.2-501s1c1
Sequence:CCGGCCTGAAAGAATCCTGTCTTATCTCGAGATAAGACAGGATTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020188.2-389s1c1
Sequence:CCGGTGGCATTGCAATGCGAAAGAACTCGAGTTCTTTCGCATTGCAATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_020188.2-248s1c1
Sequence:CCGGCGTCTTGATTAACTTGCTTAACTCGAGTTAAGCAAGTTAATCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020188.2-345s1c1
Sequence:CCGGCTGAAGAATGAGTACGTAGAACTCGAGTTCTACGTACTCATTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020188.2-237s1c1
Sequence:CCGGGAAGAATGCAACGTCTTGATTCTCGAGAATCAAGACGTTGCATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020188.3-497s21c1
Sequence:CCGGCCTGAAAGAATCCTGTCTTATCTCGAGATAAGACAGGATTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020188.3-385s21c1
Sequence:CCGGTGGCATTGCAATGCGAAAGAACTCGAGTTCTTTCGCATTGCAATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020188.3-233s21c1
Sequence:CCGGGAAGAATGCAACGTCTTGATTCTCGAGAATCAAGACGTTGCATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020188.3-244s21c1
Sequence:CCGGCGTCTTGATTAACTTGCTTAACTCGAGTTAAGCAAGTTAATCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020188
VALIDATED
CMC2 MISSION shRNA shRNA Plasmid DNA
COX assembly mitochondrial protein 2 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020188.2-501s1c1
Sequence:CCGGCCTGAAAGAATCCTGTCTTATCTCGAGATAAGACAGGATTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020188.2-389s1c1
Sequence:CCGGTGGCATTGCAATGCGAAAGAACTCGAGTTCTTTCGCATTGCAATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_020188.2-248s1c1
Sequence:CCGGCGTCTTGATTAACTTGCTTAACTCGAGTTAAGCAAGTTAATCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020188.2-345s1c1
Sequence:CCGGCTGAAGAATGAGTACGTAGAACTCGAGTTCTACGTACTCATTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020188.2-237s1c1
Sequence:CCGGGAAGAATGCAACGTCTTGATTCTCGAGAATCAAGACGTTGCATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020188.3-497s21c1
Sequence:CCGGCCTGAAAGAATCCTGTCTTATCTCGAGATAAGACAGGATTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020188.3-385s21c1
Sequence:CCGGTGGCATTGCAATGCGAAAGAACTCGAGTTCTTTCGCATTGCAATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020188.3-233s21c1
Sequence:CCGGGAAGAATGCAACGTCTTGATTCTCGAGAATCAAGACGTTGCATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020188.3-244s21c1
Sequence:CCGGCGTCTTGATTAACTTGCTTAACTCGAGTTAAGCAAGTTAATCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020188
VALIDATED
CMC2 MISSION shRNA Lentiviral Transduction Particles
COX assembly mitochondrial protein 2 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020188.2-501s1c1
Sequence:CCGGCCTGAAAGAATCCTGTCTTATCTCGAGATAAGACAGGATTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020188.2-389s1c1
Sequence:CCGGTGGCATTGCAATGCGAAAGAACTCGAGTTCTTTCGCATTGCAATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_020188.2-248s1c1
Sequence:CCGGCGTCTTGATTAACTTGCTTAACTCGAGTTAAGCAAGTTAATCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020188.2-345s1c1
Sequence:CCGGCTGAAGAATGAGTACGTAGAACTCGAGTTCTACGTACTCATTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020188.2-237s1c1
Sequence:CCGGGAAGAATGCAACGTCTTGATTCTCGAGAATCAAGACGTTGCATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020188.3-497s21c1
Sequence:CCGGCCTGAAAGAATCCTGTCTTATCTCGAGATAAGACAGGATTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020188.3-385s21c1
Sequence:CCGGTGGCATTGCAATGCGAAAGAACTCGAGTTCTTTCGCATTGCAATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020188.3-233s21c1
Sequence:CCGGGAAGAATGCAACGTCTTGATTCTCGAGAATCAAGACGTTGCATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020188.3-244s21c1
Sequence:CCGGCGTCTTGATTAACTTGCTTAACTCGAGTTAAGCAAGTTAATCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks