EMAIL THIS PAGE TO A FRIEND

CMIP

c-Maf inducing protein

167 Gene Product Result for
Synonyms: TCMIP
UniProtKB ID: Q8IY22, Q9C0G9
Gene ID:
Human(80790) Summary: This gene encodes a c-Maf inducing protein that plays a role in T-cell signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(74440) c-Maf inducing protein
Rat(292051) c-Maf-inducing protein
Zebrafish(561893) c-Maf inducing protein
dog(100686020) c-Maf inducing protein
cow(782414) c-Maf inducing protein
domestic cat(101080420) c-Maf inducing protein
chicken(425774) c-Maf inducing protein
sheep(101121541) c-Maf inducing protein
naked mole-rat(101723079) c-Maf inducing protein
domestic guinea pig(100729304) c-Maf inducing protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030629 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030629 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030629 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028941 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028941 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028941 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030629 Rosetta Predictions human pricing
NM_198390 Rosetta Predictions human pricing
XM_001078448 Rosetta Predictions rat pricing
XM_214698 Rosetta Predictions rat pricing
XM_001004720 Rosetta Predictions mouse pricing
XM_001004723 Rosetta Predictions mouse pricing
XM_001004724 Rosetta Predictions mouse pricing
XM_895052 Rosetta Predictions mouse pricing
XM_902500 Rosetta Predictions mouse pricing
XM_902503 Rosetta Predictions mouse pricing
XM_924798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186637 predicted 1491
2 SASI_Hs01_00186638 predicted 940
3 SASI_Hs01_00186640 predicted 448
4 SASI_Hs01_00186641 predicted 1314
5 SASI_Hs01_00186642 predicted 1302
6 SASI_Hs01_00186643 predicted 602
7 SASI_Hs01_00186644 predicted 1765
8 SASI_Hs01_00186645 predicted 556
9 SASI_Hs02_00358191 predicted 1847
10 SASI_Hs02_00358192 predicted 519
11 SASI_Hs01_00186639 predicted 1266
12 SASI_Hs01_00186646 predicted 1734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048900 predicted 1596
2 SASI_Hs01_00048901 predicted 1047
3 SASI_Hs01_00048903 predicted 553
4 SASI_Hs01_00048904 predicted 1425
5 SASI_Hs01_00048905 predicted 1407
6 SASI_Hs01_00048906 predicted 709
7 SASI_Hs01_00048907 predicted 1869
8 SASI_Hs01_00048908 predicted 666
9 SASI_Hs02_00371905 predicted 1950
10 SASI_Hs02_00371906 predicted 626
11 SASI_Hs01_00048902 predicted 1378
12 SASI_Hs01_00048909 predicted 1837
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360806 predicted 1003
2 SASI_Rn02_00360807 predicted 757
3 SASI_Rn02_00360808 predicted 259
4 SASI_Rn02_00360809 predicted 906
5 SASI_Rn02_00360810 predicted 1914
6 SASI_Rn02_00360811 predicted 1475
7 SASI_Rn02_00360812 predicted 373
8 SASI_Rn02_00360813 predicted 1000
9 SASI_Rn02_00360814 predicted 815
10 SASI_Rn02_00360815 predicted 2052
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375525 predicted 1399
2 SASI_Rn02_00375526 predicted 1154
3 SASI_Rn02_00375527 predicted 647
4 SASI_Rn02_00375528 predicted 1295
5 SASI_Rn02_00375529 predicted 2310
6 SASI_Rn02_00375530 predicted 1864
7 SASI_Rn02_00375531 predicted 1389
8 SASI_Rn02_00375532 predicted 1206
9 SASI_Rn02_00375533 predicted 2447
10 SASI_Rn02_00375534 predicted 1749
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241408 predicted 392
2 SASI_Mm01_00241409 predicted 1357
3 SASI_Mm01_00241410 predicted 649
4 SASI_Mm01_00241411 predicted 1245
5 SASI_Mm01_00241412 predicted 283
6 SASI_Mm01_00241413 predicted 361
7 SASI_Mm01_00241414 predicted 872
8 SASI_Mm01_00241415 predicted 1073
9 SASI_Mm01_00241416 predicted 316
10 SASI_Mm01_00241417 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255566 predicted 595
2 SASI_Mm01_00255567 predicted 1561
3 SASI_Mm01_00255568 predicted 853
4 SASI_Mm01_00255569 predicted 452
5 SASI_Mm01_00255570 predicted 1453
6 SASI_Mm01_00255571 predicted 486
7 SASI_Mm01_00255572 predicted 562
8 SASI_Mm01_00255573 predicted 1075
9 SASI_Mm01_00255574 predicted 1283
10 SASI_Mm01_00255575 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00356342 predicted 448
2 SASI_Mm01_00220393 predicted 264
3 SASI_Mm02_00356343 predicted 908
4 SASI_Mm01_00220395 predicted 1764
5 SASI_Mm02_00356344 predicted 1059
6 SASI_Mm02_00356345 predicted 1423
7 SASI_Mm02_00356346 predicted 1650
8 SASI_Mm02_00356347 predicted 1278
9 SASI_Mm01_00220398 predicted 1479
10 SASI_Mm01_00220400 predicted 1008
11 SASI_Mm01_00220394 predicted 1026
12 SASI_Mm01_00220396 predicted 696
13 SASI_Mm01_00220397 predicted 768
14 SASI_Mm01_00220399 predicted 867
15 SASI_Mm01_00220401 predicted 389
16 SASI_Mm01_00220402 predicted 1933
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234722 predicted 915
2 SASI_Mm01_00234723 predicted 1668
3 SASI_Mm01_00234724 predicted 590
4 SASI_Mm01_00234725 predicted 672
5 SASI_Mm01_00234726 predicted 1389
6 SASI_Mm01_00234727 predicted 764
7 SASI_Mm01_00234728 predicted 913
8 SASI_Mm01_00234729 predicted 282
9 SASI_Mm01_00234730 predicted 1825
10 SASI_Mm01_00234731 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234762 predicted 3240
2 SASI_Mm01_00234763 predicted 3133
3 SASI_Mm01_00234764 predicted 4096
4 SASI_Mm01_00234765 predicted 3378
5 SASI_Mm01_00234766 predicted 3975
6 SASI_Mm01_00234767 predicted 3612
7 SASI_Mm01_00234768 predicted 3806
8 SASI_Mm01_00234769 predicted 3336
9 SASI_Mm01_00234770 predicted 4255
10 SASI_Mm01_00234771 predicted 3160
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902503 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256304 predicted 524
2 SASI_Mm01_00256305 predicted 1489
3 SASI_Mm01_00256306 predicted 780
4 SASI_Mm01_00256307 predicted 373
5 SASI_Mm01_00256308 predicted 1375
6 SASI_Mm01_00256309 predicted 409
7 SASI_Mm01_00256310 predicted 492
8 SASI_Mm01_00256311 predicted 1001
9 SASI_Mm01_00256312 predicted 1208
10 SASI_Mm01_00256313 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_924798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444317 predicted 267
2 SASI_Mm02_00444318 predicted 1016
3 SASI_Mm02_00444319 predicted 1763
4 SASI_Mm02_00444320 predicted 222
5 SASI_Mm02_00444321 predicted 688
6 SASI_Mm02_00444322 predicted 763
7 SASI_Mm02_00444323 predicted 1479
8 SASI_Mm02_00444324 predicted 860
9 SASI_Mm02_00444325 predicted 1004
10 SASI_Mm02_00444326 predicted 380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030629
VALIDATED
CMIP MISSION shRNA Bacterial Glycerol Stock
c-Maf inducing protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-1225s21c1
Sequence:CCGGTCAAGCTGCTGTCAGACTATGCTCGAGCATAGTCTGACAGCAGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-169s21c1
Sequence:CCGGCAGTCTCCTACAGCGCAATTGCTCGAGCAATTGCGCTGTAGGAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-1327s21c1
Sequence:CCGGAGGAACTGAAGTACGTGATTCCTCGAGGAATCACGTACTTCAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-2378s21c1
Sequence:CCGGGAACCTTTGACCTGATCTAAACTCGAGTTTAGATCAGGTCAAAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-262s21c1
Sequence:CCGGTCTTACTGCAGGCTGCCAATACTCGAGTATTGGCAGCCTGCAGTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-871s21c1
Sequence:CCGGTCATCAACAGCCGCGACAATTCTCGAGAATTGTCGCGGCTGTTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030629.1-2750s1c1
Sequence:CCGGGCCTCTTATTTATGAAGTCTTCTCGAGAAGACTTCATAAATAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030629.1-656s1c1
Sequence:CCGGCCTCAAGCATAACATGGACTTCTCGAGAAGTCCATGTTATGCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030629.1-453s1c1
Sequence:CCGGCCACTGGAAATCGTCTCGAAACTCGAGTTTCGAGACGATTTCCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030629.1-1266s1c1
Sequence:CCGGGCCAGTTTGCTTCAACCCATTCTCGAGAATGGGTTGAAGCAAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030629.1-650s1c1
Sequence:CCGGGCGAATCCTCAAGCATAACATCTCGAGATGTTATGCTTGAGGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030629
VALIDATED
CMIP MISSION shRNA shRNA Plasmid DNA
c-Maf inducing protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-1225s21c1
Sequence:CCGGTCAAGCTGCTGTCAGACTATGCTCGAGCATAGTCTGACAGCAGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-169s21c1
Sequence:CCGGCAGTCTCCTACAGCGCAATTGCTCGAGCAATTGCGCTGTAGGAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-1327s21c1
Sequence:CCGGAGGAACTGAAGTACGTGATTCCTCGAGGAATCACGTACTTCAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-2378s21c1
Sequence:CCGGGAACCTTTGACCTGATCTAAACTCGAGTTTAGATCAGGTCAAAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-262s21c1
Sequence:CCGGTCTTACTGCAGGCTGCCAATACTCGAGTATTGGCAGCCTGCAGTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-871s21c1
Sequence:CCGGTCATCAACAGCCGCGACAATTCTCGAGAATTGTCGCGGCTGTTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030629.1-2750s1c1
Sequence:CCGGGCCTCTTATTTATGAAGTCTTCTCGAGAAGACTTCATAAATAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030629.1-656s1c1
Sequence:CCGGCCTCAAGCATAACATGGACTTCTCGAGAAGTCCATGTTATGCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030629.1-453s1c1
Sequence:CCGGCCACTGGAAATCGTCTCGAAACTCGAGTTTCGAGACGATTTCCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030629.1-1266s1c1
Sequence:CCGGGCCAGTTTGCTTCAACCCATTCTCGAGAATGGGTTGAAGCAAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030629.1-650s1c1
Sequence:CCGGGCGAATCCTCAAGCATAACATCTCGAGATGTTATGCTTGAGGATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030629
VALIDATED
CMIP MISSION shRNA Lentiviral Transduction Particles
c-Maf inducing protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-1225s21c1
Sequence:CCGGTCAAGCTGCTGTCAGACTATGCTCGAGCATAGTCTGACAGCAGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-169s21c1
Sequence:CCGGCAGTCTCCTACAGCGCAATTGCTCGAGCAATTGCGCTGTAGGAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-1327s21c1
Sequence:CCGGAGGAACTGAAGTACGTGATTCCTCGAGGAATCACGTACTTCAGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-2378s21c1
Sequence:CCGGGAACCTTTGACCTGATCTAAACTCGAGTTTAGATCAGGTCAAAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-262s21c1
Sequence:CCGGTCTTACTGCAGGCTGCCAATACTCGAGTATTGGCAGCCTGCAGTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030629.2-871s21c1
Sequence:CCGGTCATCAACAGCCGCGACAATTCTCGAGAATTGTCGCGGCTGTTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030629.1-2750s1c1
Sequence:CCGGGCCTCTTATTTATGAAGTCTTCTCGAGAAGACTTCATAAATAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030629.1-656s1c1
Sequence:CCGGCCTCAAGCATAACATGGACTTCTCGAGAAGTCCATGTTATGCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030629.1-453s1c1
Sequence:CCGGCCACTGGAAATCGTCTCGAAACTCGAGTTTCGAGACGATTTCCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030629.1-1266s1c1
Sequence:CCGGGCCAGTTTGCTTCAACCCATTCTCGAGAATGGGTTGAAGCAAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030629.1-650s1c1
Sequence:CCGGGCGAATCCTCAAGCATAACATCTCGAGATGTTATGCTTGAGGATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028941
VALIDATED
CMIP MISSION shRNA Bacterial Glycerol Stock
c-Maf inducing protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-758s21c1
Sequence:CCGGGCTCTTCACCCAGGAGTATATCTCGAGATATACTCCTGGGTGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-2174s21c1
Sequence:CCGGGGCCAAGCTTCCTAACCTAAACTCGAGTTTAGGTTAGGAAGCTTGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-1174s21c1
Sequence:CCGGACAGCGAGCCCAACCTTATTGCTCGAGCAATAAGGTTGGGCTCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-2459s21c1
Sequence:CCGGCTAATTCTTAGAGCTTCATATCTCGAGATATGAAGCTCTAAGAATTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-1387s21c1
Sequence:CCGGAGGAACTGAAGTACGTGATTCCTCGAGGAATCACGTACTTCAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-702s21c1
Sequence:CCGGGTGGTTCAGAGGATCCTTAAACTCGAGTTTAAGGATCCTCTGAACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028941.1-2022s21c1
Sequence:CCGGCTTTCGGAGCACCTCACTATGCTCGAGCATAGTGAGGTGCTCCGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028941
VALIDATED
CMIP MISSION shRNA shRNA Plasmid DNA
c-Maf inducing protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-758s21c1
Sequence:CCGGGCTCTTCACCCAGGAGTATATCTCGAGATATACTCCTGGGTGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-2174s21c1
Sequence:CCGGGGCCAAGCTTCCTAACCTAAACTCGAGTTTAGGTTAGGAAGCTTGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-1174s21c1
Sequence:CCGGACAGCGAGCCCAACCTTATTGCTCGAGCAATAAGGTTGGGCTCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-2459s21c1
Sequence:CCGGCTAATTCTTAGAGCTTCATATCTCGAGATATGAAGCTCTAAGAATTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-1387s21c1
Sequence:CCGGAGGAACTGAAGTACGTGATTCCTCGAGGAATCACGTACTTCAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-702s21c1
Sequence:CCGGGTGGTTCAGAGGATCCTTAAACTCGAGTTTAAGGATCCTCTGAACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028941.1-2022s21c1
Sequence:CCGGCTTTCGGAGCACCTCACTATGCTCGAGCATAGTGAGGTGCTCCGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028941
VALIDATED
CMIP MISSION shRNA Lentiviral Transduction Particles
c-Maf inducing protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-758s21c1
Sequence:CCGGGCTCTTCACCCAGGAGTATATCTCGAGATATACTCCTGGGTGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-2174s21c1
Sequence:CCGGGGCCAAGCTTCCTAACCTAAACTCGAGTTTAGGTTAGGAAGCTTGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-1174s21c1
Sequence:CCGGACAGCGAGCCCAACCTTATTGCTCGAGCAATAAGGTTGGGCTCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-2459s21c1
Sequence:CCGGCTAATTCTTAGAGCTTCATATCTCGAGATATGAAGCTCTAAGAATTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-1387s21c1
Sequence:CCGGAGGAACTGAAGTACGTGATTCCTCGAGGAATCACGTACTTCAGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028941.1-702s21c1
Sequence:CCGGGTGGTTCAGAGGATCCTTAAACTCGAGTTTAAGGATCCTCTGAACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028941.1-2022s21c1
Sequence:CCGGCTTTCGGAGCACCTCACTATGCTCGAGCATAGTGAGGTGCTCCGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)