EMAIL THIS PAGE TO A FRIEND

CMKLR1

chemokine-like receptor 1

58 Gene Product Result for
Synonyms: CHEMERINR ChemR23 DEZ RVER1
UniProtKB ID: Q99788, A8K6Y5, O75748, Q3KP37, Q5U0H0, Q99789
Gene ID:
Mouse(14747) chemokine-like receptor 1
Rat(60669) chemokine-like receptor 1
Zebrafish(557341) chemokine-like receptor 1
cow(615411) chemokine-like receptor 1
domestic cat(101089147) chemokine-like receptor 1
dog(486321) chemokine-like receptor 1
domestic guinea pig(100735973) chemokine-like receptor 1
naked mole-rat(101711500) chemokine-like receptor 1
sheep(101103843) chemokine-like receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008153 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008153 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008153 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004072 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004072 Rosetta Predictions human pricing
NM_022218 Rosetta Predictions rat pricing
NM_008153 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336867 predicted 1494
2 SASI_Hs01_00235586 predicted 826
3 SASI_Hs01_00235587 predicted 721
4 SASI_Hs01_00235588 predicted 1275
5 SASI_Hs01_00235589 predicted 795
6 SASI_Hs02_00336868 predicted 769
7 SASI_Hs01_00235591 predicted 1144
8 SASI_Hs01_00235592 predicted 1503
9 SASI_Hs01_00235593 predicted 1559
10 SASI_Hs01_00235594 predicted 771
11 SASI_Hs01_00235590 predicted 1352
12 SASI_Hs01_00235595 predicted 1682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034911 predicted 1471
2 SASI_Rn01_00034912 predicted 193
3 SASI_Rn01_00034913 predicted 632
4 SASI_Rn01_00034914 predicted 850
5 SASI_Rn01_00034915 predicted 295
6 SASI_Rn01_00034916 predicted 1147
7 SASI_Rn01_00034917 predicted 702
8 SASI_Rn01_00034918 predicted 1411
9 SASI_Rn01_00034920 predicted 426
10 SASI_Rn02_00262976 predicted 1442
11 SASI_Rn01_00034919 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027373 predicted 466
2 SASI_Mm01_00027374 predicted 1470
3 SASI_Mm02_00313253 predicted 625
4 SASI_Mm01_00027377 predicted 1493
5 SASI_Mm01_00027378 predicted 321
6 SASI_Mm01_00027379 predicted 271
7 SASI_Mm01_00027380 predicted 963
8 SASI_Mm01_00027381 predicted 874
9 SASI_Mm02_00313254 predicted 288
10 SASI_Mm01_00027382 predicted 428
11 SASI_Mm01_00027375 predicted 581
12 SASI_Mm01_00027376 predicted 1115
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008153
CMKLR1 MISSION shRNA Bacterial Glycerol Stock
chemokine-like receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008153.1-799s1c1
Sequence:CCGGGCCAACATTCATGGGAAGATACTCGAGTATCTTCCCATGAATGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008153.1-1328s1c1
Sequence:CCGGCGTCTTTGAATGAGAAGGCTTCTCGAGAAGCCTTCTCATTCAAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008153.1-879s1c1
Sequence:CCGGGCAAGTAGTTTCCACAGGGTACTCGAGTACCCTGTGGAAACTACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008153.1-510s1c1
Sequence:CCGGCGACTTCCTGTTCAACATCTTCTCGAGAAGATGTTGAACAGGAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008153.1-321s1c1
Sequence:CCGGCTTTGGCTACTTTGTGGACTTCTCGAGAAGTCCACAAAGTAGCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008153
CMKLR1 MISSION shRNA shRNA Plasmid DNA
chemokine-like receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008153.1-799s1c1
Sequence:CCGGGCCAACATTCATGGGAAGATACTCGAGTATCTTCCCATGAATGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008153.1-1328s1c1
Sequence:CCGGCGTCTTTGAATGAGAAGGCTTCTCGAGAAGCCTTCTCATTCAAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008153.1-879s1c1
Sequence:CCGGGCAAGTAGTTTCCACAGGGTACTCGAGTACCCTGTGGAAACTACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008153.1-510s1c1
Sequence:CCGGCGACTTCCTGTTCAACATCTTCTCGAGAAGATGTTGAACAGGAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008153.1-321s1c1
Sequence:CCGGCTTTGGCTACTTTGTGGACTTCTCGAGAAGTCCACAAAGTAGCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008153
CMKLR1 MISSION shRNA Lentiviral Transduction Particles
chemokine-like receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008153.1-799s1c1
Sequence:CCGGGCCAACATTCATGGGAAGATACTCGAGTATCTTCCCATGAATGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008153.1-1328s1c1
Sequence:CCGGCGTCTTTGAATGAGAAGGCTTCTCGAGAAGCCTTCTCATTCAAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008153.1-879s1c1
Sequence:CCGGGCAAGTAGTTTCCACAGGGTACTCGAGTACCCTGTGGAAACTACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008153.1-510s1c1
Sequence:CCGGCGACTTCCTGTTCAACATCTTCTCGAGAAGATGTTGAACAGGAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008153.1-321s1c1
Sequence:CCGGCTTTGGCTACTTTGTGGACTTCTCGAGAAGTCCACAAAGTAGCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004072
CMKLR1 MISSION shRNA Bacterial Glycerol Stock
chemokine-like receptor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004072.1-561s1c1
Sequence:CCGGCCCTGATTATTTAGACTCCATCTCGAGATGGAGTCTAAATAATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004072.1-969s1c1
Sequence:CCGGCCTGGCTTACATGGCCTGCATCTCGAGATGCAGGCCATGTAAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004072.1-1281s1c1
Sequence:CCGGCTTCAAGATTATTGTGACCATCTCGAGATGGTCACAATAATCTTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004072.1-1562s1c1
Sequence:CCGGGCTTTACCAAGATGTCATCAACTCGAGTTGATGACATCTTGGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004072.1-1710s1c1
Sequence:CCGGCCTCTTTAGCATCCACCAATTCTCGAGAATTGGTGGATGCTAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004072.2-1497s21c1
Sequence:CCGGTCGCCTGGTCAATGCTCTAAGCTCGAGCTTAGAGCATTGACCAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004072.2-2037s21c1
Sequence:CCGGATCACACTTGGCCCTTGTATACTCGAGTATACAAGGGCCAAGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004072.2-546s21c1
Sequence:CCGGTGATGAATACCCTGATTATTTCTCGAGAAATAATCAGGGTATTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004072.2-1823s21c1
Sequence:CCGGAGCCTTGGACTAGCAATTTATCTCGAGATAAATTGCTAGTCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004072
CMKLR1 MISSION shRNA shRNA Plasmid DNA
chemokine-like receptor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004072.1-561s1c1
Sequence:CCGGCCCTGATTATTTAGACTCCATCTCGAGATGGAGTCTAAATAATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004072.1-969s1c1
Sequence:CCGGCCTGGCTTACATGGCCTGCATCTCGAGATGCAGGCCATGTAAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004072.1-1281s1c1
Sequence:CCGGCTTCAAGATTATTGTGACCATCTCGAGATGGTCACAATAATCTTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004072.1-1562s1c1
Sequence:CCGGGCTTTACCAAGATGTCATCAACTCGAGTTGATGACATCTTGGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004072.1-1710s1c1
Sequence:CCGGCCTCTTTAGCATCCACCAATTCTCGAGAATTGGTGGATGCTAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004072.2-1497s21c1
Sequence:CCGGTCGCCTGGTCAATGCTCTAAGCTCGAGCTTAGAGCATTGACCAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004072.2-2037s21c1
Sequence:CCGGATCACACTTGGCCCTTGTATACTCGAGTATACAAGGGCCAAGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004072.2-546s21c1
Sequence:CCGGTGATGAATACCCTGATTATTTCTCGAGAAATAATCAGGGTATTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004072.2-1823s21c1
Sequence:CCGGAGCCTTGGACTAGCAATTTATCTCGAGATAAATTGCTAGTCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004072
CMKLR1 MISSION shRNA Lentiviral Transduction Particles
chemokine-like receptor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004072.1-561s1c1
Sequence:CCGGCCCTGATTATTTAGACTCCATCTCGAGATGGAGTCTAAATAATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004072.1-969s1c1
Sequence:CCGGCCTGGCTTACATGGCCTGCATCTCGAGATGCAGGCCATGTAAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004072.1-1281s1c1
Sequence:CCGGCTTCAAGATTATTGTGACCATCTCGAGATGGTCACAATAATCTTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004072.1-1562s1c1
Sequence:CCGGGCTTTACCAAGATGTCATCAACTCGAGTTGATGACATCTTGGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004072.1-1710s1c1
Sequence:CCGGCCTCTTTAGCATCCACCAATTCTCGAGAATTGGTGGATGCTAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004072.2-1497s21c1
Sequence:CCGGTCGCCTGGTCAATGCTCTAAGCTCGAGCTTAGAGCATTGACCAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004072.2-2037s21c1
Sequence:CCGGATCACACTTGGCCCTTGTATACTCGAGTATACAAGGGCCAAGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004072.2-546s21c1
Sequence:CCGGTGATGAATACCCTGATTATTTCTCGAGAAATAATCAGGGTATTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004072.2-1823s21c1
Sequence:CCGGAGCCTTGGACTAGCAATTTATCTCGAGATAAATTGCTAGTCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks