EMAIL THIS PAGE TO A FRIEND

CMPK1

cytidine monophosphate (UMP-CMP) kinase 1, cytosolic

227 Gene Product Result for
Synonyms: CK CMK CMPK UMK UMP-CMPK UMPK
Gene ID:
Human(51727) Summary: This gene encodes one of the enzymes required for cellular nucleic acid biosynthesis. This enzyme catalyzes the transfer of a phosphate group from ATP to CMP, UMP, or dCMP, to form the corresponding diphosphate nucleotide. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Feb 2012]
Mouse(66588) cytidine monophosphate (UMP-CMP) kinase 1
Rat(298410) cytidine monophosphate (UMP-CMP) kinase 1
chicken(429100) cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
dog(610291) cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
cow(509965) cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
domestic cat(101084043) cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
sheep(101106892) cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
domestic guinea pig(100712683) cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
naked mole-rat(101703729) cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C2994 Anti-CMPK (181-195) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C2869 Anti-CMPK (71-85) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1407519 Anti-CMPK antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA053730 Anti-CMPK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA058604 Anti-CMPK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2107657 Anti-CMPK1 antibody produced in rabbit affinity isolated antibody human, rabbit, mouse, guinea pig, horse
ELISA, western blot pricing
SAB1410948 Anti-CMPK1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4502166 Anti-KCY, N-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB1306433 ANTI-UCK(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB1306432 ANTI-UCK(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB1402586 Monoclonal Anti-CMPK antibody produced in mouse clone 1D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016308 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025647 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025647 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025647 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016308 Rosetta Predictions human pricing
NM_001025655 Rosetta Predictions rat pricing
NM_025647 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349236 predicted 325
2 SASI_Hs01_00102326 predicted 303
3 SASI_Hs01_00102327 predicted 603
4 SASI_Hs01_00102328 predicted 392
5 SASI_Hs01_00102329 predicted 592
6 SASI_Hs01_00102330 predicted 367
7 SASI_Hs01_00102331 predicted 461
8 SASI_Hs01_00102332 predicted 295
9 SASI_Hs01_00102333 predicted 259
10 SASI_Hs01_00102334 predicted 256
11 SASI_Hs01_00102325 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121866 predicted 551
2 SASI_Rn01_00121867 predicted 771
3 SASI_Rn01_00121869 predicted 555
4 SASI_Rn01_00121870 predicted 392
5 SASI_Rn01_00121872 predicted 645
6 SASI_Rn01_00121873 predicted 433
7 SASI_Rn01_00121874 predicted 432
8 SASI_Rn02_00203231 predicted 364
9 SASI_Rn02_00203232 predicted 873
10 SASI_Rn02_00203233 predicted 790
11 SASI_Rn01_00121868 predicted 721
12 SASI_Rn01_00121871 predicted 454
13 SASI_Rn01_00121875 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056340 predicted 663
2 SASI_Mm01_00056341 predicted 560
3 SASI_Mm01_00056342 predicted 547
4 SASI_Mm01_00056343 predicted 366
5 SASI_Mm01_00056344 predicted 357
6 SASI_Mm01_00056345 predicted 660
7 SASI_Mm01_00056346 predicted 331
8 SASI_Mm01_00056347 predicted 474
9 SASI_Mm01_00056348 predicted 635
10 SASI_Mm02_00328754 predicted 436
11 SASI_Mm01_00056349 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016308
VALIDATED
CMPK1 MISSION shRNA Bacterial Glycerol Stock
cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016308.2-306s21c1
Sequence:CCGGGCCCGCATCGTCGAGAAATATCTCGAGATATTTCTCGACGATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016308.2-486s21c1
Sequence:CCGGGCTGCCAATGCTCAGAAGAATCTCGAGATTCTTCTGAGCATTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016308.2-618s21c1
Sequence:CCGGGAGATTTGTATTGAACGATGTCTCGAGACATCGTTCAATACAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016308.2-710s21c1
Sequence:CCGGCCTTCAGTCAACAAAGCCAATCTCGAGATTGGCTTTGTTGACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-1037s1c1
Sequence:CCGGCCCTCTAGTAATCACAACATTCTCGAGAATGTTGTGATTACTAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-591s1c1
Sequence:CCGGCCTTCAGTCAACAAAGCCAATCTCGAGATTGGCTTTGTTGACTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-259s1c1
Sequence:CCGGCCAGATTCACAGTATGGTGAACTCGAGTTCACCATACTGTGAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-367s1c1
Sequence:CCGGGCTGCCAATGCTCAGAAGAATCTCGAGATTCTTCTGAGCATTGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-409s1c1
Sequence:CCGGCCAAGAAATCAAGACAACCTTCTCGAGAAGGTTGTCTTGATTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016308.1-539s1c1
Sequence:CCGGGTGGTAGGAGTGATGACAACACTCGAGTGTTGTCATCACTCCTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-187s1c1
Sequence:CCGGGCCCGCATCGTCGAGAAATATCTCGAGATATTTCTCGACGATGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016308.1-1503s1c1
Sequence:CCGGGAAATGCATGTGGCTAGATTTCTCGAGAAATCTAGCCACATGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016308.1-2259s1c1
Sequence:CCGGGAGATAGGAATGAGTTCTTATCTCGAGATAAGAACTCATTCCTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-499s1c1
Sequence:CCGGGAGATTTGTATTGAACGATGTCTCGAGACATCGTTCAATACAAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016308.1-583s1c1
Sequence:CCGGCAGACCTACCTTCAGTCAACACTCGAGTGTTGACTGAAGGTAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016308
VALIDATED
CMPK1 MISSION shRNA shRNA Plasmid DNA
cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016308.2-306s21c1
Sequence:CCGGGCCCGCATCGTCGAGAAATATCTCGAGATATTTCTCGACGATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016308.2-486s21c1
Sequence:CCGGGCTGCCAATGCTCAGAAGAATCTCGAGATTCTTCTGAGCATTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016308.2-618s21c1
Sequence:CCGGGAGATTTGTATTGAACGATGTCTCGAGACATCGTTCAATACAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016308.2-710s21c1
Sequence:CCGGCCTTCAGTCAACAAAGCCAATCTCGAGATTGGCTTTGTTGACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-1037s1c1
Sequence:CCGGCCCTCTAGTAATCACAACATTCTCGAGAATGTTGTGATTACTAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-591s1c1
Sequence:CCGGCCTTCAGTCAACAAAGCCAATCTCGAGATTGGCTTTGTTGACTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-259s1c1
Sequence:CCGGCCAGATTCACAGTATGGTGAACTCGAGTTCACCATACTGTGAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-367s1c1
Sequence:CCGGGCTGCCAATGCTCAGAAGAATCTCGAGATTCTTCTGAGCATTGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-409s1c1
Sequence:CCGGCCAAGAAATCAAGACAACCTTCTCGAGAAGGTTGTCTTGATTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016308.1-539s1c1
Sequence:CCGGGTGGTAGGAGTGATGACAACACTCGAGTGTTGTCATCACTCCTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-187s1c1
Sequence:CCGGGCCCGCATCGTCGAGAAATATCTCGAGATATTTCTCGACGATGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016308.1-1503s1c1
Sequence:CCGGGAAATGCATGTGGCTAGATTTCTCGAGAAATCTAGCCACATGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016308.1-2259s1c1
Sequence:CCGGGAGATAGGAATGAGTTCTTATCTCGAGATAAGAACTCATTCCTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-499s1c1
Sequence:CCGGGAGATTTGTATTGAACGATGTCTCGAGACATCGTTCAATACAAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016308.1-583s1c1
Sequence:CCGGCAGACCTACCTTCAGTCAACACTCGAGTGTTGACTGAAGGTAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016308
VALIDATED
CMPK1 MISSION shRNA Lentiviral Transduction Particles
cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016308.2-306s21c1
Sequence:CCGGGCCCGCATCGTCGAGAAATATCTCGAGATATTTCTCGACGATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016308.2-486s21c1
Sequence:CCGGGCTGCCAATGCTCAGAAGAATCTCGAGATTCTTCTGAGCATTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016308.2-618s21c1
Sequence:CCGGGAGATTTGTATTGAACGATGTCTCGAGACATCGTTCAATACAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016308.2-710s21c1
Sequence:CCGGCCTTCAGTCAACAAAGCCAATCTCGAGATTGGCTTTGTTGACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-1037s1c1
Sequence:CCGGCCCTCTAGTAATCACAACATTCTCGAGAATGTTGTGATTACTAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-591s1c1
Sequence:CCGGCCTTCAGTCAACAAAGCCAATCTCGAGATTGGCTTTGTTGACTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-259s1c1
Sequence:CCGGCCAGATTCACAGTATGGTGAACTCGAGTTCACCATACTGTGAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-367s1c1
Sequence:CCGGGCTGCCAATGCTCAGAAGAATCTCGAGATTCTTCTGAGCATTGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-409s1c1
Sequence:CCGGCCAAGAAATCAAGACAACCTTCTCGAGAAGGTTGTCTTGATTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016308.1-539s1c1
Sequence:CCGGGTGGTAGGAGTGATGACAACACTCGAGTGTTGTCATCACTCCTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-187s1c1
Sequence:CCGGGCCCGCATCGTCGAGAAATATCTCGAGATATTTCTCGACGATGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016308.1-1503s1c1
Sequence:CCGGGAAATGCATGTGGCTAGATTTCTCGAGAAATCTAGCCACATGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016308.1-2259s1c1
Sequence:CCGGGAGATAGGAATGAGTTCTTATCTCGAGATAAGAACTCATTCCTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016308.1-499s1c1
Sequence:CCGGGAGATTTGTATTGAACGATGTCTCGAGACATCGTTCAATACAAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016308.1-583s1c1
Sequence:CCGGCAGACCTACCTTCAGTCAACACTCGAGTGTTGACTGAAGGTAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025647
VALIDATED
CMPK1 MISSION shRNA Bacterial Glycerol Stock
cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025647.3-648s21c1
Sequence:CCGGACTTACCTTGAATCAACGAAACTCGAGTTTCGTTGATTCAAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025647.3-764s21c1
Sequence:CCGGTGACAAAGAAGGCTAACTAACCTCGAGGTTAGTTAGCCTTCTTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025647.3-321s21c1
Sequence:CCGGCCAGACTCACAGTATGGTGAACTCGAGTTCACCATACTGTGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025647.3-1002s21c1
Sequence:CCGGGAAGAAGGGTATCAGCTAATTCTCGAGAATTAGCTGATACCCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025647.3-383s21c1
Sequence:CCGGTGAGATAACCATCAGTTTATTCTCGAGAATAAACTGATGGTTATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025647.2-581s1c1
Sequence:CCGGCCTTGAATCAACGAAACCAATCTCGAGATTGGTTTCGTTGATTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025647.2-249s1c1
Sequence:CCGGCCAGACTCACAGTATGGTGAACTCGAGTTCACCATACTGTGAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025647.2-253s1c1
Sequence:CCGGACTCACAGTATGGTGAACTTACTCGAGTAAGTTCACCATACTGTGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025647.2-576s1c1
Sequence:CCGGACTTACCTTGAATCAACGAAACTCGAGTTTCGTTGATTCAAGGTAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025647.2-84s1c1
Sequence:CCGGACCCGCAGACTGTGGCTCTTTCTCGAGAAAGAGCCACAGTCTGCGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025647
VALIDATED
CMPK1 MISSION shRNA shRNA Plasmid DNA
cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025647.3-648s21c1
Sequence:CCGGACTTACCTTGAATCAACGAAACTCGAGTTTCGTTGATTCAAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025647.3-764s21c1
Sequence:CCGGTGACAAAGAAGGCTAACTAACCTCGAGGTTAGTTAGCCTTCTTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025647.3-321s21c1
Sequence:CCGGCCAGACTCACAGTATGGTGAACTCGAGTTCACCATACTGTGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025647.3-1002s21c1
Sequence:CCGGGAAGAAGGGTATCAGCTAATTCTCGAGAATTAGCTGATACCCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025647.3-383s21c1
Sequence:CCGGTGAGATAACCATCAGTTTATTCTCGAGAATAAACTGATGGTTATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025647.2-581s1c1
Sequence:CCGGCCTTGAATCAACGAAACCAATCTCGAGATTGGTTTCGTTGATTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025647.2-249s1c1
Sequence:CCGGCCAGACTCACAGTATGGTGAACTCGAGTTCACCATACTGTGAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025647.2-253s1c1
Sequence:CCGGACTCACAGTATGGTGAACTTACTCGAGTAAGTTCACCATACTGTGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025647.2-576s1c1
Sequence:CCGGACTTACCTTGAATCAACGAAACTCGAGTTTCGTTGATTCAAGGTAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025647.2-84s1c1
Sequence:CCGGACCCGCAGACTGTGGCTCTTTCTCGAGAAAGAGCCACAGTCTGCGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025647
VALIDATED
CMPK1 MISSION shRNA Lentiviral Transduction Particles
cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025647.3-648s21c1
Sequence:CCGGACTTACCTTGAATCAACGAAACTCGAGTTTCGTTGATTCAAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025647.3-764s21c1
Sequence:CCGGTGACAAAGAAGGCTAACTAACCTCGAGGTTAGTTAGCCTTCTTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025647.3-321s21c1
Sequence:CCGGCCAGACTCACAGTATGGTGAACTCGAGTTCACCATACTGTGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025647.3-1002s21c1
Sequence:CCGGGAAGAAGGGTATCAGCTAATTCTCGAGAATTAGCTGATACCCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025647.3-383s21c1
Sequence:CCGGTGAGATAACCATCAGTTTATTCTCGAGAATAAACTGATGGTTATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025647.2-581s1c1
Sequence:CCGGCCTTGAATCAACGAAACCAATCTCGAGATTGGTTTCGTTGATTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025647.2-249s1c1
Sequence:CCGGCCAGACTCACAGTATGGTGAACTCGAGTTCACCATACTGTGAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025647.2-253s1c1
Sequence:CCGGACTCACAGTATGGTGAACTTACTCGAGTAAGTTCACCATACTGTGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025647.2-576s1c1
Sequence:CCGGACTTACCTTGAATCAACGAAACTCGAGTTTCGTTGATTCAAGGTAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025647.2-84s1c1
Sequence:CCGGACCCGCAGACTGTGGCTCTTTCTCGAGAAAGAGCCACAGTCTGCGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks