EMAIL THIS PAGE TO A FRIEND

CMPK2

cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial

59 Gene Product Result for
Synonyms: TMPK2 TYKi UMP-CMPK2
UniProtKB ID: Q5EBM0, A2RUB0, A5D8T2, B7ZM18, Q6ZRU2, Q96AL8
Gene ID:
Human(129607) Summary: This gene encodes one of the enzymes in the nucleotide synthesis salvage pathway that may participate in terminal differentiation of monocytic cells. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(22169) cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
Rat(314004) cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
naked mole-rat(101712024) cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
domestic guinea pig(100724819) cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
sheep(101123366) cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
Zebrafish(570478) cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
chicken(421921) cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
dog(608996) cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
cow(784304) cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
domestic cat(101096470) cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207315 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020557 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020557 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020557 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207315 Rosetta Predictions human pricing
NM_001108017 Rosetta Predictions rat pricing
NM_020557 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373847 predicted 1719
2 SASI_Hs02_00373848 predicted 1520
3 SASI_Hs02_00373849 predicted 1069
4 SASI_Hs02_00373850 predicted 928
5 SASI_Hs02_00373851 predicted 1418
6 SASI_Hs02_00373852 predicted 1077
7 SASI_Hs02_00373853 predicted 1729
8 SASI_Hs02_00373854 predicted 1425
9 SASI_Hs02_00373855 predicted 1536
10 SASI_Hs02_00373856 predicted 1059
11 SASI_Hs01_00064123 predicted 736
12 SASI_Hs01_00064124 predicted 985
13 SASI_Hs01_00064125 predicted 1016
14 SASI_Hs01_00064126 predicted 888
15 SASI_Hs01_00064127 predicted 1031
16 SASI_Hs01_00064128 predicted 1058
17 SASI_Hs01_00064129 predicted 879
18 SASI_Hs01_00064130 predicted 1014
19 SASI_Hs01_00064131 predicted 911
20 SASI_Hs01_00064132 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234545 predicted 1715
2 SASI_Rn02_00234546 predicted 724
3 SASI_Rn02_00234547 predicted 686
4 SASI_Rn02_00234548 predicted 863
5 SASI_Rn02_00234549 predicted 956
6 SASI_Rn02_00234550 predicted 1824
7 SASI_Rn02_00234551 predicted 1006
8 SASI_Rn02_00234552 predicted 1222
9 SASI_Rn02_00234553 predicted 608
10 SASI_Rn02_00234554 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325585 predicted 253
2 SASI_Mm01_00040722 predicted 1099
3 SASI_Mm01_00040723 predicted 1113
4 SASI_Mm01_00040724 predicted 1365
5 SASI_Mm01_00040726 predicted 1868
6 SASI_Mm01_00040727 predicted 1015
7 SASI_Mm01_00040728 predicted 840
8 SASI_Mm01_00040729 predicted 804
9 SASI_Mm01_00040730 predicted 1100
10 SASI_Mm01_00040731 predicted 1055
11 SASI_Mm01_00040725 predicted 1745
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207315
VALIDATED
CMPK2 MISSION shRNA Bacterial Glycerol Stock
cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_207315.1-1422s1c1
Sequence:CCGGCCCAGAAGAACATCTCAGATACTCGAGTATCTGAGATGTTCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207315.1-1423s1c1
Sequence:CCGGCCAGAAGAACATCTCAGATATCTCGAGATATCTGAGATGTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207315.1-953s1c1
Sequence:CCGGCAGAAAGGAAAGTTCCAGGTTCTCGAGAACCTGGAACTTTCCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_207315.1-947s1c1
Sequence:CCGGCAGATCCAGAAAGGAAAGTTCCTCGAGGAACTTTCCTTTCTGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207315.1-949s1c1
Sequence:CCGGGATCCAGAAAGGAAAGTTCCACTCGAGTGGAACTTTCCTTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_207315.1-1021s1c1
Sequence:CCGGGTCAGTGGCAGATTCACTTAACTCGAGTTAAGTGAATCTGCCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207315.2-1308s21c1
Sequence:CCGGTTGAGGCCAACAGTGTGTTTCCTCGAGGAAACACACTGTTGGCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207315.2-1076s21c1
Sequence:CCGGGCCAAATCTCCTGTGATTGTACTCGAGTACAATCACAGGAGATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207315.2-1690s21c1
Sequence:CCGGCTTTCTTCCTGGCATAGTAAACTCGAGTTTACTATGCCAGGAAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207315.2-884s21c1
Sequence:CCGGGGACTGGATGCCACGGGTAAACTCGAGTTTACCCGTGGCATCCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207315.2-999s21c1
Sequence:CCGGATGAACCAACTATCATTAGAACTCGAGTTCTAATGATAGTTGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207315
VALIDATED
CMPK2 MISSION shRNA shRNA Plasmid DNA
cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_207315.1-1422s1c1
Sequence:CCGGCCCAGAAGAACATCTCAGATACTCGAGTATCTGAGATGTTCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207315.1-1423s1c1
Sequence:CCGGCCAGAAGAACATCTCAGATATCTCGAGATATCTGAGATGTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207315.1-953s1c1
Sequence:CCGGCAGAAAGGAAAGTTCCAGGTTCTCGAGAACCTGGAACTTTCCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_207315.1-947s1c1
Sequence:CCGGCAGATCCAGAAAGGAAAGTTCCTCGAGGAACTTTCCTTTCTGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207315.1-949s1c1
Sequence:CCGGGATCCAGAAAGGAAAGTTCCACTCGAGTGGAACTTTCCTTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_207315.1-1021s1c1
Sequence:CCGGGTCAGTGGCAGATTCACTTAACTCGAGTTAAGTGAATCTGCCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207315.2-1308s21c1
Sequence:CCGGTTGAGGCCAACAGTGTGTTTCCTCGAGGAAACACACTGTTGGCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207315.2-1076s21c1
Sequence:CCGGGCCAAATCTCCTGTGATTGTACTCGAGTACAATCACAGGAGATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207315.2-1690s21c1
Sequence:CCGGCTTTCTTCCTGGCATAGTAAACTCGAGTTTACTATGCCAGGAAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207315.2-884s21c1
Sequence:CCGGGGACTGGATGCCACGGGTAAACTCGAGTTTACCCGTGGCATCCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207315.2-999s21c1
Sequence:CCGGATGAACCAACTATCATTAGAACTCGAGTTCTAATGATAGTTGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207315
VALIDATED
CMPK2 MISSION shRNA Lentiviral Transduction Particles
cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_207315.1-1422s1c1
Sequence:CCGGCCCAGAAGAACATCTCAGATACTCGAGTATCTGAGATGTTCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207315.1-1423s1c1
Sequence:CCGGCCAGAAGAACATCTCAGATATCTCGAGATATCTGAGATGTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207315.1-953s1c1
Sequence:CCGGCAGAAAGGAAAGTTCCAGGTTCTCGAGAACCTGGAACTTTCCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_207315.1-947s1c1
Sequence:CCGGCAGATCCAGAAAGGAAAGTTCCTCGAGGAACTTTCCTTTCTGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207315.1-949s1c1
Sequence:CCGGGATCCAGAAAGGAAAGTTCCACTCGAGTGGAACTTTCCTTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_207315.1-1021s1c1
Sequence:CCGGGTCAGTGGCAGATTCACTTAACTCGAGTTAAGTGAATCTGCCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207315.2-1308s21c1
Sequence:CCGGTTGAGGCCAACAGTGTGTTTCCTCGAGGAAACACACTGTTGGCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207315.2-1076s21c1
Sequence:CCGGGCCAAATCTCCTGTGATTGTACTCGAGTACAATCACAGGAGATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207315.2-1690s21c1
Sequence:CCGGCTTTCTTCCTGGCATAGTAAACTCGAGTTTACTATGCCAGGAAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207315.2-884s21c1
Sequence:CCGGGGACTGGATGCCACGGGTAAACTCGAGTTTACCCGTGGCATCCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207315.2-999s21c1
Sequence:CCGGATGAACCAACTATCATTAGAACTCGAGTTCTAATGATAGTTGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020557
CMPK2 MISSION shRNA Bacterial Glycerol Stock
cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020557.3-2152s1c1
Sequence:CCGGGCACTTTGAATGTCTTCTGATCTCGAGATCAGAAGACATTCAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020557.3-1187s1c1
Sequence:CCGGGTTTCGTCAGAAGGTGGAAATCTCGAGATTTCCACCTTCTGACGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020557.3-927s1c1
Sequence:CCGGGCTAAAGAATCAACCAACTTTCTCGAGAAAGTTGGTTGATTCTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020557.3-590s1c1
Sequence:CCGGTCTGCTTAACTCTGCGGTGTTCTCGAGAACACCGCAGAGTTAAGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020557.4-1102s21c1
Sequence:GTACCGGCAACCAACTTTCCTGTTATTGCTCGAGCAATAACAGGAAAGTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020557.4-1078s21c1
Sequence:GTACCGGTGGCTTCTGAAATAGCTAAAGCTCGAGCTTTAGCTATTTCAGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020557.4-1683s21c1
Sequence:CCGGTACCAACTTCTTGGGATATATCTCGAGATATATCCCAAGAAGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020557.4-1463s21c1
Sequence:CCGGCCAGAGTTCTGGTCGTTAATTCTCGAGAATTAACGACCAGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020557
CMPK2 MISSION shRNA shRNA Plasmid DNA
cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020557.3-2152s1c1
Sequence:CCGGGCACTTTGAATGTCTTCTGATCTCGAGATCAGAAGACATTCAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020557.3-1187s1c1
Sequence:CCGGGTTTCGTCAGAAGGTGGAAATCTCGAGATTTCCACCTTCTGACGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020557.3-927s1c1
Sequence:CCGGGCTAAAGAATCAACCAACTTTCTCGAGAAAGTTGGTTGATTCTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020557.3-590s1c1
Sequence:CCGGTCTGCTTAACTCTGCGGTGTTCTCGAGAACACCGCAGAGTTAAGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020557.4-1102s21c1
Sequence:GTACCGGCAACCAACTTTCCTGTTATTGCTCGAGCAATAACAGGAAAGTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020557.4-1078s21c1
Sequence:GTACCGGTGGCTTCTGAAATAGCTAAAGCTCGAGCTTTAGCTATTTCAGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020557.4-1683s21c1
Sequence:CCGGTACCAACTTCTTGGGATATATCTCGAGATATATCCCAAGAAGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020557.4-1463s21c1
Sequence:CCGGCCAGAGTTCTGGTCGTTAATTCTCGAGAATTAACGACCAGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020557
CMPK2 MISSION shRNA Lentiviral Transduction Particles
cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020557.3-2152s1c1
Sequence:CCGGGCACTTTGAATGTCTTCTGATCTCGAGATCAGAAGACATTCAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020557.3-1187s1c1
Sequence:CCGGGTTTCGTCAGAAGGTGGAAATCTCGAGATTTCCACCTTCTGACGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020557.3-927s1c1
Sequence:CCGGGCTAAAGAATCAACCAACTTTCTCGAGAAAGTTGGTTGATTCTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020557.3-590s1c1
Sequence:CCGGTCTGCTTAACTCTGCGGTGTTCTCGAGAACACCGCAGAGTTAAGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020557.4-1102s21c1
Sequence:GTACCGGCAACCAACTTTCCTGTTATTGCTCGAGCAATAACAGGAAAGTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020557.4-1078s21c1
Sequence:GTACCGGTGGCTTCTGAAATAGCTAAAGCTCGAGCTTTAGCTATTTCAGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020557.4-1683s21c1
Sequence:CCGGTACCAACTTCTTGGGATATATCTCGAGATATATCCCAAGAAGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020557.4-1463s21c1
Sequence:CCGGCCAGAGTTCTGGTCGTTAATTCTCGAGAATTAACGACCAGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks