EMAIL THIS PAGE TO A FRIEND

CMSS1

cms1 ribosomal small subunit homolog (yeast)

74 Gene Product Result for
Synonyms: C3orf26
UniProtKB ID: Q9BQ75, A8K5S7, B4DUM1, E9PHS3
Gene ID:
Mouse(66497) cms small ribosomal subunit 1
Rat(288176) cms1 ribosomal small subunit homolog (yeast)
sheep(101108270) cms1 ribosomal small subunit homolog (yeast)
domestic guinea pig(100721704) cms1 ribosomal small subunit homolog (yeast)
Zebrafish(450027) cms1 ribosomal small subunit homolog (yeast)
domestic cat(101092388) cms1 ribosomal small subunit homolog (yeast)
cow(616567) cms1 ribosomal small subunit homolog (yeast)
dog(478538) cms1 ribosomal small subunit homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032359 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032359 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032359 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032359 Rosetta Predictions human pricing
NM_001013866 Rosetta Predictions rat pricing
NM_025599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134709 predicted 673
2 SASI_Hs01_00134710 predicted 880
3 SASI_Hs01_00134711 predicted 907
4 SASI_Hs01_00134712 predicted 798
5 SASI_Hs01_00134713 predicted 925
6 SASI_Hs01_00134714 predicted 935
7 SASI_Hs01_00134715 predicted 940
8 SASI_Hs01_00134716 predicted 669
9 SASI_Hs01_00134717 predicted 592
10 SASI_Hs01_00134718 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112433 predicted 271
2 SASI_Rn01_00112434 predicted 770
3 SASI_Rn01_00112435 predicted 463
4 SASI_Rn02_00201134 predicted 842
5 SASI_Rn01_00112436 predicted 641
6 SASI_Rn01_00112439 predicted 851
7 SASI_Rn01_00112440 predicted 399
8 SASI_Rn01_00112441 predicted 930
9 SASI_Rn01_00112442 predicted 627
10 SASI_Rn02_00201135 predicted 390
11 SASI_Rn01_00112437 predicted 588
12 SASI_Rn01_00112438 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328604 predicted 670
2 SASI_Mm01_00175129 predicted 855
3 SASI_Mm01_00175130 predicted 665
4 SASI_Mm01_00175131 predicted 657
5 SASI_Mm01_00175132 predicted 822
6 SASI_Mm01_00175133 predicted 593
7 SASI_Mm01_00175134 predicted 869
8 SASI_Mm01_00175135 predicted 583
9 SASI_Mm01_00175136 predicted 648
10 SASI_Mm01_00175138 predicted 269
11 SASI_Mm01_00175137 predicted 771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032359
VALIDATED
CMSS1 MISSION shRNA Bacterial Glycerol Stock
cms1 ribosomal small subunit homolog (yeast)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032359.2-1058s1c1
Sequence:CCGGGCACTCAGTAAATATCAGCAACTCGAGTTGCTGATATTTACTGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032359.2-731s1c1
Sequence:CCGGGCAGGTAAAGTTGCTGGAGAACTCGAGTTCTCCAGCAACTTTACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032359.2-462s1c1
Sequence:CCGGCGCTTGGTGATTGAATTAGAACTCGAGTTCTAATTCAATCACCAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_032359.2-896s1c1
Sequence:CCGGCGAGATAAGAAAGGAGGTATTCTCGAGAATACCTCCTTTCTTATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032359.2-894s1c1
Sequence:CCGGCCCGAGATAAGAAAGGAGGTACTCGAGTACCTCCTTTCTTATCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032359
VALIDATED
CMSS1 MISSION shRNA shRNA Plasmid DNA
cms1 ribosomal small subunit homolog (yeast)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032359.2-1058s1c1
Sequence:CCGGGCACTCAGTAAATATCAGCAACTCGAGTTGCTGATATTTACTGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032359.2-731s1c1
Sequence:CCGGGCAGGTAAAGTTGCTGGAGAACTCGAGTTCTCCAGCAACTTTACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032359.2-462s1c1
Sequence:CCGGCGCTTGGTGATTGAATTAGAACTCGAGTTCTAATTCAATCACCAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_032359.2-896s1c1
Sequence:CCGGCGAGATAAGAAAGGAGGTATTCTCGAGAATACCTCCTTTCTTATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032359.2-894s1c1
Sequence:CCGGCCCGAGATAAGAAAGGAGGTACTCGAGTACCTCCTTTCTTATCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032359
VALIDATED
CMSS1 MISSION shRNA Lentiviral Transduction Particles
cms1 ribosomal small subunit homolog (yeast)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032359.2-1058s1c1
Sequence:CCGGGCACTCAGTAAATATCAGCAACTCGAGTTGCTGATATTTACTGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032359.2-731s1c1
Sequence:CCGGGCAGGTAAAGTTGCTGGAGAACTCGAGTTCTCCAGCAACTTTACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032359.2-462s1c1
Sequence:CCGGCGCTTGGTGATTGAATTAGAACTCGAGTTCTAATTCAATCACCAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_032359.2-896s1c1
Sequence:CCGGCGAGATAAGAAAGGAGGTATTCTCGAGAATACCTCCTTTCTTATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032359.2-894s1c1
Sequence:CCGGCCCGAGATAAGAAAGGAGGTACTCGAGTACCTCCTTTCTTATCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025599
VALIDATED
CMSS1 MISSION shRNA Bacterial Glycerol Stock
cms1 ribosomal small subunit homolog (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025599.1-955s1c1
Sequence:CCGGGTCCTGATGAAGAGTCCAGTTCTCGAGAACTGGACTCTTCATCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025599.1-427s1c1
Sequence:CCGGCGTTCCGTGATAGAATTAGAACTCGAGTTCTAATTCTATCACGGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025599.1-837s1c1
Sequence:CCGGGCTGAGGAGAATGATGGACATCTCGAGATGTCCATCATTCTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025599.1-885s1c1
Sequence:CCGGGCTTCTAGATATGGGAGTGTTCTCGAGAACACTCCCATATCTAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025599.1-426s1c1
Sequence:CCGGCCGTTCCGTGATAGAATTAGACTCGAGTCTAATTCTATCACGGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025599
VALIDATED
CMSS1 MISSION shRNA shRNA Plasmid DNA
cms1 ribosomal small subunit homolog (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025599.1-955s1c1
Sequence:CCGGGTCCTGATGAAGAGTCCAGTTCTCGAGAACTGGACTCTTCATCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025599.1-427s1c1
Sequence:CCGGCGTTCCGTGATAGAATTAGAACTCGAGTTCTAATTCTATCACGGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025599.1-837s1c1
Sequence:CCGGGCTGAGGAGAATGATGGACATCTCGAGATGTCCATCATTCTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025599.1-885s1c1
Sequence:CCGGGCTTCTAGATATGGGAGTGTTCTCGAGAACACTCCCATATCTAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025599.1-426s1c1
Sequence:CCGGCCGTTCCGTGATAGAATTAGACTCGAGTCTAATTCTATCACGGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025599
VALIDATED
CMSS1 MISSION shRNA Lentiviral Transduction Particles
cms1 ribosomal small subunit homolog (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025599.1-955s1c1
Sequence:CCGGGTCCTGATGAAGAGTCCAGTTCTCGAGAACTGGACTCTTCATCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025599.1-427s1c1
Sequence:CCGGCGTTCCGTGATAGAATTAGAACTCGAGTTCTAATTCTATCACGGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025599.1-837s1c1
Sequence:CCGGGCTGAGGAGAATGATGGACATCTCGAGATGTCCATCATTCTCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025599.1-885s1c1
Sequence:CCGGGCTTCTAGATATGGGAGTGTTCTCGAGAACACTCCCATATCTAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025599.1-426s1c1
Sequence:CCGGCCGTTCCGTGATAGAATTAGACTCGAGTCTAATTCTATCACGGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)