EMAIL THIS PAGE TO A FRIEND

CMTM1

CKLF-like MARVEL transmembrane domain containing 1

216 Gene Product Result for
Synonyms: CKLFH CKLFH1 CKLFSF1
Gene ID:
Human(113540) Summary: This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and the transmembrane 4 superfamilies of signaling molecules. The protein encoded by this gene may play an important role in testicular development. Alternatively spliced transcript variants encoding different isoforms have been identified. Naturally occurring read-through transcription occurs between this locus and the neighboring locus CKLF (chemokine-like factor).[provided by RefSeq, Feb 2011]
Mouse(100504164) CKLF-like MARVEL transmembrane domain containing 1
Rat(291823) CKLF-like MARVEL transmembrane domain containing 1
dog(611367) CKLF-like MARVEL transmembrane domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181292 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152191 MISSION® esiRNA esiRNA human CMTM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052999 Rosetta Predictions human pricing
NM_181268 Rosetta Predictions human pricing
NM_181269 Rosetta Predictions human pricing
NM_181270 Rosetta Predictions human pricing
NM_181271 Rosetta Predictions human pricing
NM_181272 Rosetta Predictions human pricing
NM_181283 Rosetta Predictions human pricing
NM_181289 Rosetta Predictions human pricing
NM_181296 Rosetta Predictions human pricing
NM_001029914 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361819 predicted 790
2 SASI_Hs02_00361820 predicted 505
3 SASI_Hs01_00046097 predicted 547
4 SASI_Hs02_00361821 predicted 369
5 SASI_Hs02_00361822 predicted 163
6 SASI_Hs02_00361823 predicted 628
7 SASI_Hs02_00361824 predicted 359
8 SASI_Hs02_00361825 predicted 559
9 SASI_Hs02_00361826 predicted 489
10 SASI_Hs02_00361827 predicted 359
11 SASI_Hs01_00046088 predicted 510
12 SASI_Hs01_00046089 predicted 517
13 SASI_Hs01_00046090 predicted 546
14 SASI_Hs01_00046091 predicted 511
15 SASI_Hs01_00046092 predicted 514
16 SASI_Hs01_00046093 predicted 543
17 SASI_Hs01_00046094 predicted 483
18 SASI_Hs01_00046095 predicted 710
19 SASI_Hs01_00046096 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369947 predicted 775
2 SASI_Hs02_00369948 predicted 507
3 SASI_Hs01_00125481 predicted 542
4 SASI_Hs02_00369949 predicted 370
5 SASI_Hs02_00369950 predicted 156
6 SASI_Hs02_00369951 predicted 631
7 SASI_Hs02_00369952 predicted 358
8 SASI_Hs02_00369953 predicted 552
9 SASI_Hs02_00369954 predicted 491
10 SASI_Hs02_00369955 predicted 364
11 SASI_Hs01_00125474 predicted 494
12 SASI_Hs01_00125475 predicted 505
13 SASI_Hs01_00125476 predicted 529
14 SASI_Hs01_00125477 predicted 496
15 SASI_Hs01_00125478 predicted 522
16 SASI_Hs01_00125479 predicted 469
17 SASI_Hs01_00125480 predicted 695
18 SASI_Hs01_00125482 predicted 452
19 SASI_Hs01_00125483 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112494 predicted 514
2 SASI_Hs01_00112495 predicted 520
3 SASI_Hs01_00112496 predicted 540
4 SASI_Hs01_00112497 predicted 510
5 SASI_Hs01_00112498 predicted 513
6 SASI_Hs01_00112499 predicted 537
7 SASI_Hs01_00112500 predicted 493
8 SASI_Hs01_00112501 predicted 488
9 SASI_Hs01_00112502 predicted 212
10 SASI_Hs01_00112503 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035646 predicted 503
2 SASI_Hs01_00035647 predicted 500
3 SASI_Hs01_00035648 predicted 523
4 SASI_Hs01_00035649 predicted 504
5 SASI_Hs01_00035650 predicted 524
6 SASI_Hs01_00035651 predicted 477
7 SASI_Hs01_00035652 predicted 463
8 SASI_Hs01_00035653 predicted 215
9 SASI_Hs01_00035654 predicted 532
10 SASI_Hs01_00035655 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100850 predicted 354
2 SASI_Hs01_00100851 predicted 209
3 SASI_Hs01_00100852 predicted 342
4 SASI_Hs01_00100853 predicted 205
5 SASI_Hs01_00100854 predicted 317
6 SASI_Hs01_00100856 predicted 353
7 SASI_Hs01_00100857 predicted 199
8 SASI_Hs01_00100858 predicted 325
9 SASI_Hs01_00100859 predicted 197
10 SASI_Hs02_00369956 predicted 315
11 SASI_Hs01_00100855 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244190 predicted 335
2 SASI_Hs01_00244191 predicted 328
3 SASI_Hs02_00369957 predicted 314
4 SASI_Hs01_00244192 predicted 297
5 SASI_Hs01_00244193 predicted 219
6 SASI_Hs01_00244194 predicted 342
7 SASI_Hs01_00244196 predicted 313
8 SASI_Hs01_00244197 predicted 299
9 SASI_Hs02_00369958 predicted 354
10 SASI_Hs02_00369959 predicted 358
11 SASI_Hs01_00244195 predicted 217
12 SASI_Hs01_00244198 predicted 208
13 SASI_Hs01_00244199 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096864 predicted 326
2 SASI_Hs01_00096865 predicted 338
3 SASI_Hs01_00096866 predicted 308
4 SASI_Hs01_00096867 predicted 297
5 SASI_Hs01_00096868 predicted 222
6 SASI_Hs01_00096869 predicted 317
7 SASI_Hs01_00096870 predicted 219
8 SASI_Hs01_00096871 predicted 201
9 SASI_Hs02_00369960 predicted 342
10 SASI_Hs01_00096873 predicted 294
11 SASI_Hs01_00096872 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027616 predicted 208
2 SASI_Hs01_00027617 predicted 221
3 SASI_Hs01_00027618 predicted 219
4 SASI_Hs01_00027619 predicted 209
5 SASI_Hs01_00027620 predicted 211
6 SASI_Hs01_00027621 predicted 219
7 SASI_Hs01_00027622 predicted 199
8 SASI_Hs01_00027623 predicted 211
9 SASI_Hs01_00027624 predicted 200
10 SASI_Hs01_00027625 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173096 predicted 226
2 SASI_Hs01_00173097 predicted 239
3 SASI_Hs01_00173098 predicted 213
4 SASI_Hs01_00173099 predicted 203
5 SASI_Hs01_00173100 predicted 223
6 SASI_Hs02_00369961 predicted 192
7 SASI_Hs01_00173101 predicted 237
8 SASI_Hs01_00173102 predicted 266
9 SASI_Hs01_00173103 predicted 223
10 SASI_Hs01_00173104 predicted 243
11 SASI_Hs01_00173105 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203480 predicted 656
2 SASI_Rn01_00121446 predicted 1274
3 SASI_Rn01_00121447 predicted 993
4 SASI_Rn01_00121448 predicted 636
5 SASI_Rn01_00121449 predicted 835
6 SASI_Rn01_00121450 predicted 609
7 SASI_Rn01_00121451 predicted 748
8 SASI_Rn01_00121452 predicted 585
9 SASI_Rn01_00121453 predicted 1257
10 SASI_Rn01_00121454 predicted 1033
11 SASI_Rn01_00121445 predicted 775
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181292
CMTM1 MISSION shRNA Bacterial Glycerol Stock
CKLF-like MARVEL transmembrane domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181292.1-196s1c1
Sequence:CCGGGCTCTCTCTGTCCCACAGAATCTCGAGATTCTGTGGGACAGAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181292.1-163s1c1
Sequence:CCGGGACCTATTTACATTGGCCCTTCTCGAGAAGGGCCAATGTAAATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181292.1-152s1c1
Sequence:CCGGCACCACTTGCTGACCTATTTACTCGAGTAAATAGGTCAGCAAGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181292.1-372s1c1
Sequence:CCGGGCTGTGTTCCTTTCAGTAGTTCTCGAGAACTACTGAAAGGAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181292.1-233s1c1
Sequence:CCGGAGACAAAGCAAATATGAGCAACTCGAGTTGCTCATATTTGCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181292
CMTM1 MISSION shRNA shRNA Plasmid DNA
CKLF-like MARVEL transmembrane domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181292.1-196s1c1
Sequence:CCGGGCTCTCTCTGTCCCACAGAATCTCGAGATTCTGTGGGACAGAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181292.1-163s1c1
Sequence:CCGGGACCTATTTACATTGGCCCTTCTCGAGAAGGGCCAATGTAAATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181292.1-152s1c1
Sequence:CCGGCACCACTTGCTGACCTATTTACTCGAGTAAATAGGTCAGCAAGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181292.1-372s1c1
Sequence:CCGGGCTGTGTTCCTTTCAGTAGTTCTCGAGAACTACTGAAAGGAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181292.1-233s1c1
Sequence:CCGGAGACAAAGCAAATATGAGCAACTCGAGTTGCTCATATTTGCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181292
CMTM1 MISSION shRNA Lentiviral Transduction Particles
CKLF-like MARVEL transmembrane domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181292.1-196s1c1
Sequence:CCGGGCTCTCTCTGTCCCACAGAATCTCGAGATTCTGTGGGACAGAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181292.1-163s1c1
Sequence:CCGGGACCTATTTACATTGGCCCTTCTCGAGAAGGGCCAATGTAAATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181292.1-152s1c1
Sequence:CCGGCACCACTTGCTGACCTATTTACTCGAGTAAATAGGTCAGCAAGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181292.1-372s1c1
Sequence:CCGGGCTGTGTTCCTTTCAGTAGTTCTCGAGAACTACTGAAAGGAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181292.1-233s1c1
Sequence:CCGGAGACAAAGCAAATATGAGCAACTCGAGTTGCTCATATTTGCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks