EMAIL THIS PAGE TO A FRIEND

CMTM2

CKLF-like MARVEL transmembrane domain containing 2

33 Gene Product Result for
Synonyms: CKLFSF2
UniProtKB ID: Q8TAZ6, Q5I2A4, Q8N7E5
Gene ID:
Human(146225) Summary: This gene belongs to the chemokine-like factor gene superfamily, a novel family that links the chemokine and the transmembrane 4 superfamilies of signaling molecules. The protein encoded by this gene may play an important role in testicular development. [provided by RefSeq, Jul 2008]
cow(520499) CKLF-like MARVEL transmembrane domain containing 2
dog(479694) CKLF-like MARVEL transmembrane domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144673 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144673 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144673 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028671 MISSION® esiRNA esiRNA human CMTM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144673 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158354 predicted 435
2 SASI_Hs01_00158355 predicted 243
3 SASI_Hs01_00158356 predicted 787
4 SASI_Hs01_00158358 predicted 672
5 SASI_Hs01_00158359 predicted 670
6 SASI_Hs01_00158360 predicted 685
7 SASI_Hs01_00158362 predicted 442
8 SASI_Hs02_00364570 predicted 552
9 SASI_Hs01_00158363 predicted 286
10 SASI_Hs02_00364571 predicted 699
11 SASI_Hs01_00158357 predicted 793
12 SASI_Hs01_00158361 predicted 439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144673
CMTM2 MISSION shRNA Bacterial Glycerol Stock
CKLF-like MARVEL transmembrane domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144673.2-516s1c1
Sequence:CCGGCCATGGAGATATCCTTCTTCACTCGAGTGAAGAAGGATATCTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144673.2-394s1c1
Sequence:CCGGCAATAAAGAGTTCTGGCTCTTCTCGAGAAGAGCCAGAACTCTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144673.2-461s1c1
Sequence:CCGGGCAATGATACTGTTGTCCTCACTCGAGTGAGGACAACAGTATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144673.2-293s1c1
Sequence:CCGGCATAAGGAGCCATCGGACAAACTCGAGTTTGTCCGATGGCTCCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144673.2-422s1c1
Sequence:CCGGGCTGAGATCAAGATTCGGAGTCTCGAGACTCCGAATCTTGATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144673.2-226s1c1
Sequence:CCGGCAAACCCGAGGAAGACAAGAACTCGAGTTCTTGTCTTCCTCGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144673.2-694s21c1
Sequence:CCGGCTTACTTGCTGTGATCCTTATCTCGAGATAAGGATCACAGCAAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144673.2-252s21c1
Sequence:CCGGGTAAGGAGCCATCGGACAAACCTCGAGGTTTGTCCGATGGCTCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144673
CMTM2 MISSION shRNA shRNA Plasmid DNA
CKLF-like MARVEL transmembrane domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144673.2-516s1c1
Sequence:CCGGCCATGGAGATATCCTTCTTCACTCGAGTGAAGAAGGATATCTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144673.2-394s1c1
Sequence:CCGGCAATAAAGAGTTCTGGCTCTTCTCGAGAAGAGCCAGAACTCTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144673.2-461s1c1
Sequence:CCGGGCAATGATACTGTTGTCCTCACTCGAGTGAGGACAACAGTATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144673.2-293s1c1
Sequence:CCGGCATAAGGAGCCATCGGACAAACTCGAGTTTGTCCGATGGCTCCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144673.2-422s1c1
Sequence:CCGGGCTGAGATCAAGATTCGGAGTCTCGAGACTCCGAATCTTGATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144673.2-226s1c1
Sequence:CCGGCAAACCCGAGGAAGACAAGAACTCGAGTTCTTGTCTTCCTCGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144673.2-694s21c1
Sequence:CCGGCTTACTTGCTGTGATCCTTATCTCGAGATAAGGATCACAGCAAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144673.2-252s21c1
Sequence:CCGGGTAAGGAGCCATCGGACAAACCTCGAGGTTTGTCCGATGGCTCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144673
CMTM2 MISSION shRNA Lentiviral Transduction Particles
CKLF-like MARVEL transmembrane domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144673.2-516s1c1
Sequence:CCGGCCATGGAGATATCCTTCTTCACTCGAGTGAAGAAGGATATCTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144673.2-394s1c1
Sequence:CCGGCAATAAAGAGTTCTGGCTCTTCTCGAGAAGAGCCAGAACTCTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144673.2-461s1c1
Sequence:CCGGGCAATGATACTGTTGTCCTCACTCGAGTGAGGACAACAGTATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144673.2-293s1c1
Sequence:CCGGCATAAGGAGCCATCGGACAAACTCGAGTTTGTCCGATGGCTCCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144673.2-422s1c1
Sequence:CCGGGCTGAGATCAAGATTCGGAGTCTCGAGACTCCGAATCTTGATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144673.2-226s1c1
Sequence:CCGGCAAACCCGAGGAAGACAAGAACTCGAGTTCTTGTCTTCCTCGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144673.2-694s21c1
Sequence:CCGGCTTACTTGCTGTGATCCTTATCTCGAGATAAGGATCACAGCAAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144673.2-252s21c1
Sequence:CCGGGTAAGGAGCCATCGGACAAACCTCGAGGTTTGTCCGATGGCTCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks