EMAIL THIS PAGE TO A FRIEND

CMTM3

CKLF-like MARVEL transmembrane domain containing 3

99 Gene Product Result for
Synonyms: BNAS2 CKLFSF3
Gene ID:
Human(123920) Summary: This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and the transmembrane 4 superfamilies of signaling molecules. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 16. Alternatively spliced transcript variants containing different 5' UTRs, but encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Mouse(68119) CKLF-like MARVEL transmembrane domain containing 3
Rat(291813) CKLF-like MARVEL transmembrane domain containing 3
sheep(101104422) CKLF-like MARVEL transmembrane domain containing 3
domestic guinea pig(100726567) CKLF-like MARVEL transmembrane domain containing 3
naked mole-rat(101703694) CKLF-like MARVEL transmembrane domain containing 3
Zebrafish(445074) CKLF-like MARVEL transmembrane domain containing 3
dog(100686160) CKLF-like MARVEL transmembrane domain containing 3
cow(787512) CKLF-like MARVEL transmembrane domain containing 3
domestic cat(101085766) CKLF-like MARVEL transmembrane domain containing 3
chicken(414829) CKLF-like MARVEL transmembrane domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144601 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144601 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144601 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048251 Rosetta Predictions human pricing
NM_144601 Rosetta Predictions human pricing
NM_181553 Rosetta Predictions human pricing
NM_181554 Rosetta Predictions human pricing
NM_181555 Rosetta Predictions human pricing
NM_001106164 Rosetta Predictions rat pricing
XM_226200 Rosetta Predictions rat pricing
NM_024217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311822 predicted 1283
2 SASI_Hs02_00311823 predicted 605
3 SASI_Hs02_00311824 predicted 691
4 SASI_Hs02_00311825 predicted 763
5 SASI_Hs02_00311826 predicted 1237
6 SASI_Hs02_00311827 predicted 1118
7 SASI_Hs02_00311828 predicted 660
8 SASI_Hs02_00311829 predicted 1060
9 SASI_Hs02_00311830 predicted 1294
10 SASI_Hs02_00311831 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160202 predicted 1338
2 SASI_Hs01_00160203 predicted 669
3 SASI_Hs01_00160204 predicted 746
4 SASI_Hs02_00364401 predicted 817
5 SASI_Hs01_00160205 predicted 1296
6 SASI_Hs01_00160206 predicted 1178
7 SASI_Hs02_00364402 predicted 719
8 SASI_Hs01_00160207 predicted 1124
9 SASI_Hs01_00160208 predicted 1352
10 SASI_Hs01_00160209 predicted 739
11 SASI_Hs01_00160210 predicted 1337
12 SASI_Hs01_00160211 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173266 predicted 1167
2 SASI_Hs01_00173267 predicted 482
3 SASI_Hs01_00173268 predicted 570
4 SASI_Hs02_00370166 predicted 643
5 SASI_Hs01_00173269 predicted 1122
6 SASI_Hs01_00173270 predicted 1001
7 SASI_Hs02_00370167 predicted 544
8 SASI_Hs01_00173271 predicted 940
9 SASI_Hs01_00173272 predicted 1179
10 SASI_Hs01_00173273 predicted 554
11 SASI_Hs01_00173274 predicted 1158
12 SASI_Hs01_00173275 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132234 predicted 1239
2 SASI_Hs01_00132235 predicted 559
3 SASI_Hs01_00132236 predicted 639
4 SASI_Hs02_00370168 predicted 719
5 SASI_Hs01_00132237 predicted 1192
6 SASI_Hs01_00132238 predicted 1078
7 SASI_Hs02_00370169 predicted 617
8 SASI_Hs01_00132239 predicted 1015
9 SASI_Hs01_00132240 predicted 1247
10 SASI_Hs01_00132241 predicted 632
11 SASI_Hs01_00132242 predicted 1227
12 SASI_Hs01_00132243 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097368 predicted 1015
2 SASI_Hs01_00097369 predicted 346
3 SASI_Hs01_00097370 predicted 425
4 SASI_Hs01_00097371 predicted 979
5 SASI_Hs01_00097372 predicted 862
6 SASI_Hs01_00097373 predicted 803
7 SASI_Hs01_00097374 predicted 1028
8 SASI_Hs01_00097375 predicted 408
9 SASI_Hs01_00097376 predicted 1015
10 SASI_Hs01_00097377 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106164 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216258 predicted 1108
2 SASI_Rn02_00216259 predicted 1053
3 SASI_Rn02_00216260 predicted 503
4 SASI_Rn02_00216261 predicted 837
5 SASI_Rn02_00216262 predicted 769
6 SASI_Rn02_00216263 predicted 1048
7 SASI_Rn02_00216264 predicted 867
8 SASI_Rn02_00216265 predicted 396
9 SASI_Rn02_00216266 predicted 447
10 SASI_Rn02_00216267 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00134018 predicted 1158
2 SASI_Rn01_00134019 predicted 597
3 SASI_Rn01_00134020 predicted 930
4 SASI_Rn01_00134021 predicted 870
5 SASI_Rn01_00134022 predicted 1150
6 SASI_Rn01_00134023 predicted 959
7 SASI_Rn01_00134024 predicted 680
8 SASI_Rn01_00134025 predicted 484
9 SASI_Rn01_00134026 predicted 546
10 SASI_Rn01_00134027 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052682 predicted 366
2 SASI_Mm01_00052683 predicted 583
3 SASI_Mm01_00052684 predicted 1040
4 SASI_Mm01_00052685 predicted 303
5 SASI_Mm01_00052686 predicted 570
6 SASI_Mm01_00052687 predicted 580
7 SASI_Mm01_00052688 predicted 644
8 SASI_Mm01_00052689 predicted 584
9 SASI_Mm01_00052690 predicted 561
10 SASI_Mm01_00052691 predicted 783
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144601
VALIDATED
CMTM3 MISSION shRNA Bacterial Glycerol Stock
CKLF-like MARVEL transmembrane domain containing 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144601.2-467s21c1
Sequence:CCGGCGGGTCTCTCATTCATCACTTCTCGAGAAGTGATGAATGAGAGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144601.2-647s21c1
Sequence:CCGGCGGCCCTCATCTACTTTGCTACTCGAGTAGCAAAGTAGATGAGGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144601.2-740s21c1
Sequence:CCGGCCATCGTGTTTGCAACTGATTCTCGAGAATCAGTTGCAAACACGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144601.2-1831s21c1
Sequence:CCGGGCTTCTTAACAGATGGCATTTCTCGAGAAATGCCATCTGTTAAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144601.2-1831s1c1
Sequence:CCGGGCTTCTTAACAGATGGCATTTCTCGAGAAATGCCATCTGTTAAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_144601.2-740s1c1
Sequence:CCGGCCATCGTGTTTGCAACTGATTCTCGAGAATCAGTTGCAAACACGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144601.2-467s1c1
Sequence:CCGGCGGGTCTCTCATTCATCACTTCTCGAGAAGTGATGAATGAGAGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144601.2-741s1c1
Sequence:CCGGCATCGTGTTTGCAACTGATTTCTCGAGAAATCAGTTGCAAACACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144601.2-647s1c1
Sequence:CCGGCGGCCCTCATCTACTTTGCTACTCGAGTAGCAAAGTAGATGAGGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144601
VALIDATED
CMTM3 MISSION shRNA shRNA Plasmid DNA
CKLF-like MARVEL transmembrane domain containing 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144601.2-467s21c1
Sequence:CCGGCGGGTCTCTCATTCATCACTTCTCGAGAAGTGATGAATGAGAGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144601.2-647s21c1
Sequence:CCGGCGGCCCTCATCTACTTTGCTACTCGAGTAGCAAAGTAGATGAGGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144601.2-740s21c1
Sequence:CCGGCCATCGTGTTTGCAACTGATTCTCGAGAATCAGTTGCAAACACGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144601.2-1831s21c1
Sequence:CCGGGCTTCTTAACAGATGGCATTTCTCGAGAAATGCCATCTGTTAAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144601.2-1831s1c1
Sequence:CCGGGCTTCTTAACAGATGGCATTTCTCGAGAAATGCCATCTGTTAAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_144601.2-740s1c1
Sequence:CCGGCCATCGTGTTTGCAACTGATTCTCGAGAATCAGTTGCAAACACGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144601.2-467s1c1
Sequence:CCGGCGGGTCTCTCATTCATCACTTCTCGAGAAGTGATGAATGAGAGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144601.2-741s1c1
Sequence:CCGGCATCGTGTTTGCAACTGATTTCTCGAGAAATCAGTTGCAAACACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144601.2-647s1c1
Sequence:CCGGCGGCCCTCATCTACTTTGCTACTCGAGTAGCAAAGTAGATGAGGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144601
VALIDATED
CMTM3 MISSION shRNA Lentiviral Transduction Particles
CKLF-like MARVEL transmembrane domain containing 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144601.2-467s21c1
Sequence:CCGGCGGGTCTCTCATTCATCACTTCTCGAGAAGTGATGAATGAGAGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144601.2-647s21c1
Sequence:CCGGCGGCCCTCATCTACTTTGCTACTCGAGTAGCAAAGTAGATGAGGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144601.2-740s21c1
Sequence:CCGGCCATCGTGTTTGCAACTGATTCTCGAGAATCAGTTGCAAACACGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144601.2-1831s21c1
Sequence:CCGGGCTTCTTAACAGATGGCATTTCTCGAGAAATGCCATCTGTTAAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144601.2-1831s1c1
Sequence:CCGGGCTTCTTAACAGATGGCATTTCTCGAGAAATGCCATCTGTTAAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_144601.2-740s1c1
Sequence:CCGGCCATCGTGTTTGCAACTGATTCTCGAGAATCAGTTGCAAACACGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144601.2-467s1c1
Sequence:CCGGCGGGTCTCTCATTCATCACTTCTCGAGAAGTGATGAATGAGAGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144601.2-741s1c1
Sequence:CCGGCATCGTGTTTGCAACTGATTTCTCGAGAAATCAGTTGCAAACACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144601.2-647s1c1
Sequence:CCGGCGGCCCTCATCTACTTTGCTACTCGAGTAGCAAAGTAGATGAGGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024217
VALIDATED
CMTM3 MISSION shRNA Bacterial Glycerol Stock
CKLF-like MARVEL transmembrane domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024217.2-612s1c1
Sequence:CCGGGCCAAATTCCTCAAGCAAGGACTCGAGTCCTTGCTTGAGGAATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024217.2-295s1c1
Sequence:CCGGCGGGTCTTTCATTCATCACCTCTCGAGAGGTGATGAATGAAAGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024217.2-381s1c1
Sequence:CCGGGCCGTTTACTTCCTCTTTGCTCTCGAGAGCAAAGAGGAAGTAAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024217.2-564s1c1
Sequence:CCGGGCCACAATTGTGTTCGCAATTCTCGAGAATTGCGAACACAATTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024217.2-1402s1c1
Sequence:CCGGGCGGTTACTGTGTGTGTCTTTCTCGAGAAAGACACACACAGTAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024217
VALIDATED
CMTM3 MISSION shRNA shRNA Plasmid DNA
CKLF-like MARVEL transmembrane domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024217.2-612s1c1
Sequence:CCGGGCCAAATTCCTCAAGCAAGGACTCGAGTCCTTGCTTGAGGAATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024217.2-295s1c1
Sequence:CCGGCGGGTCTTTCATTCATCACCTCTCGAGAGGTGATGAATGAAAGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024217.2-381s1c1
Sequence:CCGGGCCGTTTACTTCCTCTTTGCTCTCGAGAGCAAAGAGGAAGTAAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024217.2-564s1c1
Sequence:CCGGGCCACAATTGTGTTCGCAATTCTCGAGAATTGCGAACACAATTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024217.2-1402s1c1
Sequence:CCGGGCGGTTACTGTGTGTGTCTTTCTCGAGAAAGACACACACAGTAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024217
VALIDATED
CMTM3 MISSION shRNA Lentiviral Transduction Particles
CKLF-like MARVEL transmembrane domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024217.2-612s1c1
Sequence:CCGGGCCAAATTCCTCAAGCAAGGACTCGAGTCCTTGCTTGAGGAATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024217.2-295s1c1
Sequence:CCGGCGGGTCTTTCATTCATCACCTCTCGAGAGGTGATGAATGAAAGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024217.2-381s1c1
Sequence:CCGGGCCGTTTACTTCCTCTTTGCTCTCGAGAGCAAAGAGGAAGTAAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024217.2-564s1c1
Sequence:CCGGGCCACAATTGTGTTCGCAATTCTCGAGAATTGCGAACACAATTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024217.2-1402s1c1
Sequence:CCGGGCGGTTACTGTGTGTGTCTTTCTCGAGAAAGACACACACAGTAACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)