EMAIL THIS PAGE TO A FRIEND

CMTM4

CKLF-like MARVEL transmembrane domain containing 4

Synonyms: CKLFSF4
UniProtKB ID: Q8IZR5, Q52M40, Q8IZR4, Q8IZV1
Gene ID:
Human(146223) Summary: This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and the transmembrane 4 superfamilies of signaling molecules. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 16. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(97487) CKLF-like MARVEL transmembrane domain containing 4
Rat(498902) CKLF-like MARVEL transmembrane domain containing 4
Zebrafish(436765) CKLF-like MARVEL transmembrane domain containing 4
cow(540247) CKLF-like MARVEL transmembrane domain containing 4
dog(611358) CKLF-like MARVEL transmembrane domain containing 4
chicken(415794) CKLF-like MARVEL transmembrane domain containing 4
naked mole-rat(101703104) CKLF-like MARVEL transmembrane domain containing 4
domestic guinea pig(100726299) CKLF-like MARVEL transmembrane domain containing 4
sheep(101104681) CKLF-like MARVEL transmembrane domain containing 4
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181521 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178818 Rosetta Predictions human pricing
NM_181521 Rosetta Predictions human pricing
XM_574191 Rosetta Predictions rat pricing
NM_153582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127917 predicted 377
2 SASI_Hs01_00127918 predicted 557
3 SASI_Hs01_00127919 predicted 533
4 SASI_Hs01_00127920 predicted 1194
5 SASI_Hs01_00127921 predicted 1231
6 SASI_Hs02_00369858 predicted 465
7 SASI_Hs01_00127923 predicted 1196
8 SASI_Hs01_00127924 predicted 1262
9 SASI_Hs01_00127925 predicted 1295
10 SASI_Hs01_00127926 predicted 1115
11 SASI_Hs01_00127922 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101555 predicted 379
2 SASI_Hs01_00101556 predicted 843
3 SASI_Hs02_00370141 predicted 556
4 SASI_Hs01_00101559 predicted 701
5 SASI_Hs02_00370142 predicted 886
6 SASI_Hs01_00101561 predicted 537
7 SASI_Hs01_00101562 predicted 618
8 SASI_Hs01_00101563 predicted 1107
9 SASI_Hs01_00101564 predicted 1229
10 SASI_Hs02_00370143 predicted 341
11 SASI_Hs01_00101557 predicted 673
12 SASI_Hs01_00101558 predicted 886
13 SASI_Hs01_00101560 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401593 predicted 591
2 SASI_Rn02_00401594 predicted 631
3 SASI_Rn02_00401595 predicted 378
4 SASI_Rn02_00401596 predicted 338
5 SASI_Rn02_00401597 predicted 459
6 SASI_Rn02_00401598 predicted 354
7 SASI_Rn02_00401599 predicted 499
8 SASI_Rn02_00401600 predicted 340
9 SASI_Rn02_00401601 predicted 487
10 SASI_Rn02_00401602 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048424 predicted 252
2 SASI_Mm01_00048425 predicted 310
3 SASI_Mm02_00343390 predicted 845
4 SASI_Mm02_00343391 predicted 764
5 SASI_Mm02_00343392 predicted 584
6 SASI_Mm02_00343393 predicted 502
7 SASI_Mm02_00343394 predicted 929
8 SASI_Mm02_00343395 predicted 799
9 SASI_Mm01_00048427 predicted 231
10 SASI_Mm02_00343396 predicted 503
11 SASI_Mm01_00048423 predicted 479
12 SASI_Mm01_00048426 predicted 977
13 SASI_Mm01_00048428 predicted 382
14 SASI_Mm01_00048429 predicted 976
15 SASI_Mm01_00048430 predicted 245
16 SASI_Mm01_00048431 predicted 257
17 SASI_Mm01_00048432 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181521
VALIDATED
CMTM4 MISSION shRNA Bacterial Glycerol Stock
CKLF-like MARVEL transmembrane domain containing 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181521.1-627s1c1
Sequence:CCGGGCAGAAATTGCTGCCGTGATACTCGAGTATCACGGCAGCAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181521.1-485s1c1
Sequence:CCGGGCTGATTATGTTCAGTCTCAACTCGAGTTGAGACTGAACATAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_181521.1-377s1c1
Sequence:CCGGCCTGATTGCATTCATCTGCATCTCGAGATGCAGATGAATGCAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181521.1-473s1c1
Sequence:CCGGGACTGGCGTCTTGCTGATTATCTCGAGATAATCAGCAAGACGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181521.1-725s1c1
Sequence:CCGGGCAGAGCACCAATGACTACATCTCGAGATGTAGTCATTGGTGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181521.1-667s1c1
Sequence:CCGGCGGCATATGCAGTGAACACATCTCGAGATGTGTTCACTGCATATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181521.1-536s1c1
Sequence:CCGGGAATCTGACAGATTTGGTCAACTCGAGTTGACCAAATCTGTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181521.1-530s1c1
Sequence:CCGGCAACTGGAATCTGACAGATTTCTCGAGAAATCTGTCAGATTCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181521
VALIDATED
CMTM4 MISSION shRNA shRNA Plasmid DNA
CKLF-like MARVEL transmembrane domain containing 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181521.1-627s1c1
Sequence:CCGGGCAGAAATTGCTGCCGTGATACTCGAGTATCACGGCAGCAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181521.1-485s1c1
Sequence:CCGGGCTGATTATGTTCAGTCTCAACTCGAGTTGAGACTGAACATAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_181521.1-377s1c1
Sequence:CCGGCCTGATTGCATTCATCTGCATCTCGAGATGCAGATGAATGCAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181521.1-473s1c1
Sequence:CCGGGACTGGCGTCTTGCTGATTATCTCGAGATAATCAGCAAGACGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181521.1-725s1c1
Sequence:CCGGGCAGAGCACCAATGACTACATCTCGAGATGTAGTCATTGGTGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181521.1-667s1c1
Sequence:CCGGCGGCATATGCAGTGAACACATCTCGAGATGTGTTCACTGCATATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181521.1-536s1c1
Sequence:CCGGGAATCTGACAGATTTGGTCAACTCGAGTTGACCAAATCTGTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181521.1-530s1c1
Sequence:CCGGCAACTGGAATCTGACAGATTTCTCGAGAAATCTGTCAGATTCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181521
VALIDATED
CMTM4 MISSION shRNA Lentiviral Transduction Particles
CKLF-like MARVEL transmembrane domain containing 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181521.1-627s1c1
Sequence:CCGGGCAGAAATTGCTGCCGTGATACTCGAGTATCACGGCAGCAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181521.1-485s1c1
Sequence:CCGGGCTGATTATGTTCAGTCTCAACTCGAGTTGAGACTGAACATAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_181521.1-377s1c1
Sequence:CCGGCCTGATTGCATTCATCTGCATCTCGAGATGCAGATGAATGCAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181521.1-473s1c1
Sequence:CCGGGACTGGCGTCTTGCTGATTATCTCGAGATAATCAGCAAGACGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181521.1-725s1c1
Sequence:CCGGGCAGAGCACCAATGACTACATCTCGAGATGTAGTCATTGGTGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181521.1-667s1c1
Sequence:CCGGCGGCATATGCAGTGAACACATCTCGAGATGTGTTCACTGCATATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181521.1-536s1c1
Sequence:CCGGGAATCTGACAGATTTGGTCAACTCGAGTTGACCAAATCTGTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181521.1-530s1c1
Sequence:CCGGCAACTGGAATCTGACAGATTTCTCGAGAAATCTGTCAGATTCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153582
CMTM4 MISSION shRNA Bacterial Glycerol Stock
CKLF-like MARVEL transmembrane domain containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153582.3-310s1c1
Sequence:CCGGCTCTACTTCTTTGAGTTCGTACTCGAGTACGAACTCAAAGAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153582.3-240s1c1
Sequence:CCGGCCAAGTGATTCTGGCCTTGATCTCGAGATCAAGGCCAGAATCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153582.3-401s1c1
Sequence:CCGGCCCAGATCAACTGGAATCTAACTCGAGTTAGATTCCAGTTGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153582.3-506s1c1
Sequence:CCGGCGGAAATTGCTGCCGTGATATCTCGAGATATCACGGCAGCAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153582.3-908s1c1
Sequence:CCGGCCGACTTTAATGACTGCTCTACTCGAGTAGAGCAGTCATTAAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153582
CMTM4 MISSION shRNA shRNA Plasmid DNA
CKLF-like MARVEL transmembrane domain containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153582.3-310s1c1
Sequence:CCGGCTCTACTTCTTTGAGTTCGTACTCGAGTACGAACTCAAAGAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153582.3-240s1c1
Sequence:CCGGCCAAGTGATTCTGGCCTTGATCTCGAGATCAAGGCCAGAATCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153582.3-401s1c1
Sequence:CCGGCCCAGATCAACTGGAATCTAACTCGAGTTAGATTCCAGTTGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153582.3-506s1c1
Sequence:CCGGCGGAAATTGCTGCCGTGATATCTCGAGATATCACGGCAGCAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153582.3-908s1c1
Sequence:CCGGCCGACTTTAATGACTGCTCTACTCGAGTAGAGCAGTCATTAAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153582
CMTM4 MISSION shRNA Lentiviral Transduction Particles
CKLF-like MARVEL transmembrane domain containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153582.3-310s1c1
Sequence:CCGGCTCTACTTCTTTGAGTTCGTACTCGAGTACGAACTCAAAGAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153582.3-240s1c1
Sequence:CCGGCCAAGTGATTCTGGCCTTGATCTCGAGATCAAGGCCAGAATCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153582.3-401s1c1
Sequence:CCGGCCCAGATCAACTGGAATCTAACTCGAGTTAGATTCCAGTTGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153582.3-506s1c1
Sequence:CCGGCGGAAATTGCTGCCGTGATATCTCGAGATATCACGGCAGCAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153582.3-908s1c1
Sequence:CCGGCCGACTTTAATGACTGCTCTACTCGAGTAGAGCAGTCATTAAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks