EMAIL THIS PAGE TO A FRIEND

CMTM5

CKLF-like MARVEL transmembrane domain containing 5

71 Gene Product Result for
Synonyms: CKLFSF5
UniProtKB ID: Q96DZ9, E9PH91, Q5PY48
Gene ID:
Human(116173) Summary: This gene belongs to the chemokine-like factor gene superfamily. This family of genes encodes multi-pass membrane proteins that are similar to both the chemokine and the transmembrane 4 superfamilies of signaling molecules. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(67272) CKLF-like MARVEL transmembrane domain containing 5
Rat(290214) CKLF-like MARVEL transmembrane domain containing 5
sheep(101120333) CKLF-like MARVEL transmembrane domain containing 5
domestic guinea pig(100716661) CKLF-like MARVEL transmembrane domain containing 5
naked mole-rat(101712468) CKLF-like MARVEL transmembrane domain containing 5
cow(510145) CKLF-like MARVEL transmembrane domain containing 5
domestic cat(101096485) CKLF-like MARVEL transmembrane domain containing 5
dog(608193) CKLF-like MARVEL transmembrane domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138460 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093231 MISSION® esiRNA esiRNA human CMTM5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037288 Rosetta Predictions human pricing
NM_138460 Rosetta Predictions human pricing
NM_001106034 Rosetta Predictions rat pricing
XM_214187 Rosetta Predictions rat pricing
NM_026066 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237826 predicted 458
2 SASI_Hs02_00308252 predicted 491
3 SASI_Hs01_00237827 predicted 878
4 SASI_Hs01_00237828 predicted 869
5 SASI_Hs01_00237829 predicted 632
6 SASI_Hs01_00237830 predicted 755
7 SASI_Hs01_00237831 predicted 752
8 SASI_Hs01_00237832 predicted 982
9 SASI_Hs01_00237833 predicted 678
10 SASI_Hs01_00237834 predicted 622
11 SASI_Hs01_00237835 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114916 predicted 459
2 SASI_Hs02_00363636 predicted 494
3 SASI_Hs02_00363637 predicted 734
4 SASI_Hs01_00114918 predicted 968
5 SASI_Hs01_00114919 predicted 969
6 SASI_Hs01_00114920 predicted 632
7 SASI_Hs01_00114921 predicted 851
8 SASI_Hs01_00114922 predicted 842
9 SASI_Hs01_00114923 predicted 677
10 SASI_Hs01_00114924 predicted 629
11 SASI_Hs01_00114917 predicted 828
12 SASI_Hs01_00114925 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214972 predicted 390
2 SASI_Rn02_00214973 predicted 846
3 SASI_Rn02_00214974 predicted 728
4 SASI_Rn02_00214975 predicted 565
5 SASI_Rn02_00214976 predicted 839
6 SASI_Rn02_00214977 predicted 861
7 SASI_Rn02_00214978 predicted 522
8 SASI_Rn02_00214979 predicted 626
9 SASI_Rn02_00214980 predicted 368
10 SASI_Rn02_00214981 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214187 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00123122 predicted 895
2 SASI_Rn01_00123123 predicted 614
3 SASI_Rn01_00123124 predicted 609
4 SASI_Rn01_00123125 predicted 536
5 SASI_Rn01_00123126 predicted 913
6 SASI_Rn01_00123127 predicted 889
7 SASI_Rn01_00123128 predicted 659
8 SASI_Rn01_00123129 predicted 910
9 SASI_Rn01_00123130 predicted 562
10 SASI_Rn01_00123131 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061527 predicted 582
2 SASI_Mm02_00329606 predicted 577
3 SASI_Mm01_00061528 predicted 597
4 SASI_Mm01_00061529 predicted 473
5 SASI_Mm01_00061531 predicted 618
6 SASI_Mm02_00329607 predicted 613
7 SASI_Mm01_00061532 predicted 425
8 SASI_Mm01_00061535 predicted 373
9 SASI_Mm02_00329608 predicted 355
10 SASI_Mm02_00329609 predicted 377
11 SASI_Mm01_00061526 predicted 322
12 SASI_Mm01_00061530 predicted 303
13 SASI_Mm01_00061533 predicted 273
14 SASI_Mm01_00061534 predicted 620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138460
CMTM5 MISSION shRNA Bacterial Glycerol Stock
CKLF-like MARVEL transmembrane domain containing 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138460.2-732s1c1
Sequence:CCGGGCGCTGTGTCAGTGCCATCATCTCGAGATGATGGCACTGACACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138460.2-666s1c1
Sequence:CCGGCTTCCTCTATGCCACCCAGTACTCGAGTACTGGGTGGCATAGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138460.2-629s1c1
Sequence:CCGGCGGCGCTACTGGAGTTCTTCACTCGAGTGAAGAACTCCAGTAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138460.2-861s1c1
Sequence:CCGGCAAGATCTACCGGACTGAGATCTCGAGATCTCAGTCCGGTAGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138460.2-642s1c1
Sequence:CCGGGTTCTTCATCACACTTGCCTTCTCGAGAAGGCAAGTGTGATGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138460.2-1034s21c1
Sequence:CCGGAGTCTGGCCTGAGACGTCACTCTCGAGAGTGACGTCTCAGGCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138460.2-573s21c1
Sequence:CCGGCCTGACCCTCATCATCTTCATCTCGAGATGAAGATGATGAGGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138460.2-837s21c1
Sequence:CCGGTTCCATCTTTGCCTATGATGCCTCGAGGCATCATAGGCAAAGATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138460
CMTM5 MISSION shRNA shRNA Plasmid DNA
CKLF-like MARVEL transmembrane domain containing 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138460.2-732s1c1
Sequence:CCGGGCGCTGTGTCAGTGCCATCATCTCGAGATGATGGCACTGACACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138460.2-666s1c1
Sequence:CCGGCTTCCTCTATGCCACCCAGTACTCGAGTACTGGGTGGCATAGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138460.2-629s1c1
Sequence:CCGGCGGCGCTACTGGAGTTCTTCACTCGAGTGAAGAACTCCAGTAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138460.2-861s1c1
Sequence:CCGGCAAGATCTACCGGACTGAGATCTCGAGATCTCAGTCCGGTAGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138460.2-642s1c1
Sequence:CCGGGTTCTTCATCACACTTGCCTTCTCGAGAAGGCAAGTGTGATGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138460.2-1034s21c1
Sequence:CCGGAGTCTGGCCTGAGACGTCACTCTCGAGAGTGACGTCTCAGGCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138460.2-573s21c1
Sequence:CCGGCCTGACCCTCATCATCTTCATCTCGAGATGAAGATGATGAGGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138460.2-837s21c1
Sequence:CCGGTTCCATCTTTGCCTATGATGCCTCGAGGCATCATAGGCAAAGATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138460
CMTM5 MISSION shRNA Lentiviral Transduction Particles
CKLF-like MARVEL transmembrane domain containing 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138460.2-732s1c1
Sequence:CCGGGCGCTGTGTCAGTGCCATCATCTCGAGATGATGGCACTGACACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138460.2-666s1c1
Sequence:CCGGCTTCCTCTATGCCACCCAGTACTCGAGTACTGGGTGGCATAGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138460.2-629s1c1
Sequence:CCGGCGGCGCTACTGGAGTTCTTCACTCGAGTGAAGAACTCCAGTAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138460.2-861s1c1
Sequence:CCGGCAAGATCTACCGGACTGAGATCTCGAGATCTCAGTCCGGTAGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138460.2-642s1c1
Sequence:CCGGGTTCTTCATCACACTTGCCTTCTCGAGAAGGCAAGTGTGATGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138460.2-1034s21c1
Sequence:CCGGAGTCTGGCCTGAGACGTCACTCTCGAGAGTGACGTCTCAGGCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138460.2-573s21c1
Sequence:CCGGCCTGACCCTCATCATCTTCATCTCGAGATGAAGATGATGAGGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138460.2-837s21c1
Sequence:CCGGTTCCATCTTTGCCTATGATGCCTCGAGGCATCATAGGCAAAGATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026066
CMTM5 MISSION shRNA Bacterial Glycerol Stock
CKLF-like MARVEL transmembrane domain containing 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026066.1-707s1c1
Sequence:CCGGCCCATCTTTGTCATCTTTGAACTCGAGTTCAAAGATGACAAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026066.1-579s1c1
Sequence:CCGGGTCTCCGTCTTTGCCTATGATCTCGAGATCATAGGCAAAGACGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026066.1-317s1c1
Sequence:CCGGCCTGACCTTCATCATCTTCATCTCGAGATGAAGATGATGAAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026066.1-376s1c1
Sequence:CCGGCGTTGCTAGAGTTCCTCATCACTCGAGTGATGAGGAACTCTAGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026066.1-608s1c1
Sequence:CCGGGATCTACCGAACTGAGCTGATCTCGAGATCAGCTCAGTTCGGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026066
CMTM5 MISSION shRNA shRNA Plasmid DNA
CKLF-like MARVEL transmembrane domain containing 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026066.1-707s1c1
Sequence:CCGGCCCATCTTTGTCATCTTTGAACTCGAGTTCAAAGATGACAAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026066.1-579s1c1
Sequence:CCGGGTCTCCGTCTTTGCCTATGATCTCGAGATCATAGGCAAAGACGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026066.1-317s1c1
Sequence:CCGGCCTGACCTTCATCATCTTCATCTCGAGATGAAGATGATGAAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026066.1-376s1c1
Sequence:CCGGCGTTGCTAGAGTTCCTCATCACTCGAGTGATGAGGAACTCTAGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026066.1-608s1c1
Sequence:CCGGGATCTACCGAACTGAGCTGATCTCGAGATCAGCTCAGTTCGGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026066
CMTM5 MISSION shRNA Lentiviral Transduction Particles
CKLF-like MARVEL transmembrane domain containing 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026066.1-707s1c1
Sequence:CCGGCCCATCTTTGTCATCTTTGAACTCGAGTTCAAAGATGACAAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026066.1-579s1c1
Sequence:CCGGGTCTCCGTCTTTGCCTATGATCTCGAGATCATAGGCAAAGACGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026066.1-317s1c1
Sequence:CCGGCCTGACCTTCATCATCTTCATCTCGAGATGAAGATGATGAAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026066.1-376s1c1
Sequence:CCGGCGTTGCTAGAGTTCCTCATCACTCGAGTGATGAGGAACTCTAGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026066.1-608s1c1
Sequence:CCGGGATCTACCGAACTGAGCTGATCTCGAGATCAGCTCAGTTCGGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks