EMAIL THIS PAGE TO A FRIEND

CMTM6

CKLF-like MARVEL transmembrane domain containing 6

150 Gene Product Result for
Synonyms: CKLFSF6 PRO2219
UniProtKB ID: Q9NX76, Q6IAC4
Gene ID:
Human(54918) Summary: This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and transmembrane 4 superfamilies. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 3. This gene is widely expressed in many tissues, but the exact function of the encoded protein is unknown. [provided by RefSeq, Jul 2008]
Mouse(67213) CKLF-like MARVEL transmembrane domain containing 6
Rat(316035) CKLF-like MARVEL transmembrane domain containing 6
Zebrafish(368348) CKLF-like MARVEL transmembrane domain containing 6
chicken(420667) CKLF-like MARVEL transmembrane domain containing 6
cow(508881) CKLF-like MARVEL transmembrane domain containing 6
domestic cat(101081491) CKLF-like MARVEL transmembrane domain containing 6
dog(609718) CKLF-like MARVEL transmembrane domain containing 6
naked mole-rat(101710008) CKLF-like MARVEL transmembrane domain containing 6
domestic guinea pig(100717163) CKLF-like MARVEL transmembrane domain containing 6
sheep(101112171) CKLF-like MARVEL transmembrane domain containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026036 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026036 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026036 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017801 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017801 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017801 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU030861 MISSION® esiRNA esiRNA targeting mouse Cmtm6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017801 Rosetta Predictions human pricing
NM_001007802 Rosetta Predictions rat pricing
XM_579183 Rosetta Predictions rat pricing
NM_026036 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080226 predicted 320
2 SASI_Hs01_00080227 predicted 576
3 SASI_Hs01_00080228 predicted 409
4 SASI_Hs01_00080229 predicted 609
5 SASI_Hs01_00080230 predicted 1150
6 SASI_Hs01_00080231 predicted 565
7 SASI_Hs01_00080232 predicted 443
8 SASI_Hs01_00080233 predicted 258
9 SASI_Hs01_00080234 predicted 389
10 SASI_Hs02_00350665 predicted 330
11 SASI_Hs01_00080235 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198961 predicted 320
2 SASI_Rn01_00120505 predicted 308
3 SASI_Rn01_00120506 predicted 322
4 SASI_Rn02_00198962 predicted 221
5 SASI_Rn01_00120509 predicted 229
6 SASI_Rn02_00198963 predicted 260
7 SASI_Rn02_00198964 predicted 210
8 SASI_Rn02_00198965 predicted 374
9 SASI_Rn02_00198966 predicted 314
10 SASI_Rn02_00198967 predicted 286
11 SASI_Rn01_00120507 predicted 429
12 SASI_Rn01_00120508 predicted 1048
13 SASI_Rn01_00120510 predicted 1033
14 SASI_Rn01_00120511 predicted 546
15 SASI_Rn01_00120512 predicted 454
16 SASI_Rn01_00120513 predicted 438
17 SASI_Rn01_00120514 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184765 predicted 284
2 SASI_Rn01_00184766 predicted 272
3 SASI_Rn01_00184767 predicted 333
4 SASI_Rn01_00184768 predicted 247
5 SASI_Rn01_00184769 predicted 285
6 SASI_Rn01_00184770 predicted 338
7 SASI_Rn01_00184771 predicted 233
8 SASI_Rn01_00184772 predicted 250
9 SASI_Rn01_00184773 predicted 273
10 SASI_Rn01_00184774 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026036 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145556 predicted 1055
2 SASI_Mm01_00145557 predicted 1062
3 SASI_Mm01_00145558 predicted 543
4 SASI_Mm01_00145559 predicted 225
5 SASI_Mm01_00145560 predicted 415
6 SASI_Mm01_00145561 predicted 1039
7 SASI_Mm01_00145562 predicted 445
8 SASI_Mm01_00145563 predicted 473
9 SASI_Mm02_00329528 predicted 435
10 SASI_Mm01_00145564 predicted 374
11 SASI_Mm01_00145565 predicted 1049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026036
CMTM6 MISSION shRNA Bacterial Glycerol Stock
CKLF-like MARVEL transmembrane domain containing 6
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-477s21c1
Sequence:CCGGCCTACTGGACTTCGTTGTCATCTCGAGATGACAACGAAGTCCAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-566s21c1
Sequence:CCGGCCGAACCACTGAACGCTTAAACTCGAGTTTAAGCGTTCAGTGGTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026036.3-997s21c1
Sequence:CCGGGGCGTCTTTCCTTAATGTTATCTCGAGATAACATTAAGGAAAGACGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-455s21c1
Sequence:CCGGGCTTCTTGGCAAGCTCCATGTCTCGAGACATGGAGCTTGCCAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-251s21c1
Sequence:CCGGTTGTGAGCTGTAGCGCCTTTCCTCGAGGAAAGGCGCTACAGCTCACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-199s21c1
Sequence:CCGGGAAGAGGTTGTGTCCGAGTGTCTCGAGACACTCGGACACAACCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-378s21c1
Sequence:CCGGTGTGTTCCTGCTGGCATCTATCTCGAGATAGATGCCAGCAGGAACACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026036.1-308s1c1
Sequence:CCGGCCAGTGCACGACAGAGTGGATCTCGAGATCCACTCTGTCGTGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026036.1-526s1c1
Sequence:CCGGGCTGAGAAAGCCCGAGAACAACTCGAGTTGTTCTCGGGCTTTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026036.1-426s1c1
Sequence:CCGGCCTCAGCTGAAATTGCTGCAACTCGAGTTGCAGCAATTTCAGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026036.1-963s1c1
Sequence:CCGGCCGGAGATTTAATGAGTGTTTCTCGAGAAACACTCATTAAATCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026036
CMTM6 MISSION shRNA shRNA Plasmid DNA
CKLF-like MARVEL transmembrane domain containing 6
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-477s21c1
Sequence:CCGGCCTACTGGACTTCGTTGTCATCTCGAGATGACAACGAAGTCCAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-566s21c1
Sequence:CCGGCCGAACCACTGAACGCTTAAACTCGAGTTTAAGCGTTCAGTGGTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026036.3-997s21c1
Sequence:CCGGGGCGTCTTTCCTTAATGTTATCTCGAGATAACATTAAGGAAAGACGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-455s21c1
Sequence:CCGGGCTTCTTGGCAAGCTCCATGTCTCGAGACATGGAGCTTGCCAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-251s21c1
Sequence:CCGGTTGTGAGCTGTAGCGCCTTTCCTCGAGGAAAGGCGCTACAGCTCACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-199s21c1
Sequence:CCGGGAAGAGGTTGTGTCCGAGTGTCTCGAGACACTCGGACACAACCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-378s21c1
Sequence:CCGGTGTGTTCCTGCTGGCATCTATCTCGAGATAGATGCCAGCAGGAACACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026036.1-308s1c1
Sequence:CCGGCCAGTGCACGACAGAGTGGATCTCGAGATCCACTCTGTCGTGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026036.1-526s1c1
Sequence:CCGGGCTGAGAAAGCCCGAGAACAACTCGAGTTGTTCTCGGGCTTTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026036.1-426s1c1
Sequence:CCGGCCTCAGCTGAAATTGCTGCAACTCGAGTTGCAGCAATTTCAGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026036.1-963s1c1
Sequence:CCGGCCGGAGATTTAATGAGTGTTTCTCGAGAAACACTCATTAAATCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026036
CMTM6 MISSION shRNA Lentiviral Transduction Particles
CKLF-like MARVEL transmembrane domain containing 6
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-477s21c1
Sequence:CCGGCCTACTGGACTTCGTTGTCATCTCGAGATGACAACGAAGTCCAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-566s21c1
Sequence:CCGGCCGAACCACTGAACGCTTAAACTCGAGTTTAAGCGTTCAGTGGTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026036.3-997s21c1
Sequence:CCGGGGCGTCTTTCCTTAATGTTATCTCGAGATAACATTAAGGAAAGACGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-455s21c1
Sequence:CCGGGCTTCTTGGCAAGCTCCATGTCTCGAGACATGGAGCTTGCCAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-251s21c1
Sequence:CCGGTTGTGAGCTGTAGCGCCTTTCCTCGAGGAAAGGCGCTACAGCTCACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-199s21c1
Sequence:CCGGGAAGAGGTTGTGTCCGAGTGTCTCGAGACACTCGGACACAACCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026036.3-378s21c1
Sequence:CCGGTGTGTTCCTGCTGGCATCTATCTCGAGATAGATGCCAGCAGGAACACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026036.1-308s1c1
Sequence:CCGGCCAGTGCACGACAGAGTGGATCTCGAGATCCACTCTGTCGTGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026036.1-526s1c1
Sequence:CCGGGCTGAGAAAGCCCGAGAACAACTCGAGTTGTTCTCGGGCTTTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026036.1-426s1c1
Sequence:CCGGCCTCAGCTGAAATTGCTGCAACTCGAGTTGCAGCAATTTCAGCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026036.1-963s1c1
Sequence:CCGGCCGGAGATTTAATGAGTGTTTCTCGAGAAACACTCATTAAATCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017801
CMTM6 MISSION shRNA Bacterial Glycerol Stock
CKLF-like MARVEL transmembrane domain containing 6
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017801.2-611s21c1
Sequence:CCGGCTACTTGACTTTATCACTATGCTCGAGCATAGTGATAAAGTCAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017801.2-1515s21c1
Sequence:CCGGCCCAAGACAGTGAAAGTAATTCTCGAGAATTACTTTCACTGTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017801.2-572s21c1
Sequence:CCGGGCTGCAATTGTGTTTGGATTTCTCGAGAAATCCAAACACAATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017801.2-399s21c1
Sequence:CCGGCCTTTCTTCTGAGTCTCCTTACTCGAGTAAGGAGACTCAGAAGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017801.2-692s21c1
Sequence:CCGGGCCCTCACTGAGCCACTTAATCTCGAGATTAAGTGGCTCAGTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017801.2-1515s1c1
Sequence:CCGGCCCAAGACAGTGAAAGTAATTCTCGAGAATTACTTTCACTGTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017801.2-400s1c1
Sequence:CCGGCTTTCTTCTGAGTCTCCTTATCTCGAGATAAGGAGACTCAGAAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017801.2-399s1c1
Sequence:CCGGCCTTTCTTCTGAGTCTCCTTACTCGAGTAAGGAGACTCAGAAGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017801.2-564s1c1
Sequence:CCGGCTGAGATTGCTGCAATTGTGTCTCGAGACACAATTGCAGCAATCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017801.2-572s1c1
Sequence:CCGGGCTGCAATTGTGTTTGGATTTCTCGAGAAATCCAAACACAATTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017801.2-495s1c1
Sequence:CCGGCTTTGGGAACAGGATGTGTGTCTCGAGACACACATCCTGTTCCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017801
CMTM6 MISSION shRNA shRNA Plasmid DNA
CKLF-like MARVEL transmembrane domain containing 6
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017801.2-611s21c1
Sequence:CCGGCTACTTGACTTTATCACTATGCTCGAGCATAGTGATAAAGTCAAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017801.2-1515s21c1
Sequence:CCGGCCCAAGACAGTGAAAGTAATTCTCGAGAATTACTTTCACTGTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017801.2-572s21c1
Sequence:CCGGGCTGCAATTGTGTTTGGATTTCTCGAGAAATCCAAACACAATTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017801.2-399s21c1
Sequence:CCGGCCTTTCTTCTGAGTCTCCTTACTCGAGTAAGGAGACTCAGAAGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017801.2-692s21c1
Sequence:CCGGGCCCTCACTGAGCCACTTAATCTCGAGATTAAGTGGCTCAGTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017801.2-1515s1c1
Sequence:CCGGCCCAAGACAGTGAAAGTAATTCTCGAGAATTACTTTCACTGTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017801.2-400s1c1
Sequence:CCGGCTTTCTTCTGAGTCTCCTTATCTCGAGATAAGGAGACTCAGAAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017801.2-399s1c1
Sequence:CCGGCCTTTCTTCTGAGTCTCCTTACTCGAGTAAGGAGACTCAGAAGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017801.2-564s1c1
Sequence:CCGGCTGAGATTGCTGCAATTGTGTCTCGAGACACAATTGCAGCAATCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017801.2-572s1c1
Sequence:CCGGGCTGCAATTGTGTTTGGATTTCTCGAGAAATCCAAACACAATTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017801.2-495s1c1
Sequence:CCGGCTTTGGGAACAGGATGTGTGTCTCGAGACACACATCCTGTTCCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017801
CMTM6 MISSION shRNA Lentiviral Transduction Particles
CKLF-like MARVEL transmembrane domain containing 6
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017801.2-611s21c1
Sequence:CCGGCTACTTGACTTTATCACTATGCTCGAGCATAGTGATAAAGTCAAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017801.2-1515s21c1
Sequence:CCGGCCCAAGACAGTGAAAGTAATTCTCGAGAATTACTTTCACTGTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017801.2-572s21c1
Sequence:CCGGGCTGCAATTGTGTTTGGATTTCTCGAGAAATCCAAACACAATTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017801.2-399s21c1
Sequence:CCGGCCTTTCTTCTGAGTCTCCTTACTCGAGTAAGGAGACTCAGAAGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017801.2-692s21c1
Sequence:CCGGGCCCTCACTGAGCCACTTAATCTCGAGATTAAGTGGCTCAGTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017801.2-1515s1c1
Sequence:CCGGCCCAAGACAGTGAAAGTAATTCTCGAGAATTACTTTCACTGTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017801.2-400s1c1
Sequence:CCGGCTTTCTTCTGAGTCTCCTTATCTCGAGATAAGGAGACTCAGAAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017801.2-399s1c1
Sequence:CCGGCCTTTCTTCTGAGTCTCCTTACTCGAGTAAGGAGACTCAGAAGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017801.2-564s1c1
Sequence:CCGGCTGAGATTGCTGCAATTGTGTCTCGAGACACAATTGCAGCAATCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017801.2-572s1c1
Sequence:CCGGGCTGCAATTGTGTTTGGATTTCTCGAGAAATCCAAACACAATTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017801.2-495s1c1
Sequence:CCGGCTTTGGGAACAGGATGTGTGTCTCGAGACACACATCCTGTTCCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)