EMAIL THIS PAGE TO A FRIEND

CMTM7

CKLF-like MARVEL transmembrane domain containing 7

59 Gene Product Result for
Synonyms: CKLFSF7
UniProtKB ID: Q96FZ5, Q5VLK1
Gene ID:
Human(112616) Summary: This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and transmembrane 4 superfamilies. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 3. The protein encoded by this gene is highly expressed in leukocytes, but its exact function is unknown. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(102545) CKLF-like MARVEL transmembrane domain containing 7
Rat(501065) CKLF-like MARVEL transmembrane domain containing 7
sheep(101111914) CKLF-like MARVEL transmembrane domain containing 7
domestic guinea pig(100734875) CKLF-like MARVEL transmembrane domain containing 7
naked mole-rat(101709665) CKLF-like MARVEL transmembrane domain containing 7
Zebrafish(559138) CKLF-like MARVEL transmembrane domain containing 7
chicken(420666) CKLF-like MARVEL transmembrane domain containing 7
dog(609722) CKLF-like MARVEL transmembrane domain containing 7
cow(532269) CKLF-like MARVEL transmembrane domain containing 7
domestic cat(101081246) CKLF-like MARVEL transmembrane domain containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181472 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133978 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133978 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133978 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138410 Rosetta Predictions human pricing
NM_181472 Rosetta Predictions human pricing
NM_001109300 Rosetta Predictions rat pricing
NM_133978 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181662 predicted 1100
2 SASI_Hs01_00181663 predicted 941
3 SASI_Hs01_00181664 predicted 1014
4 SASI_Hs01_00181665 predicted 1019
5 SASI_Hs01_00181666 predicted 996
6 SASI_Hs01_00181667 predicted 1038
7 SASI_Hs01_00181668 predicted 1097
8 SASI_Hs01_00181669 predicted 1093
9 SASI_Hs01_00181670 predicted 1091
10 SASI_Hs02_00363551 predicted 882
11 SASI_Hs01_00181671 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085173 predicted 996
2 SASI_Hs01_00085174 predicted 842
3 SASI_Hs01_00085175 predicted 922
4 SASI_Hs01_00085176 predicted 922
5 SASI_Hs01_00085177 predicted 890
6 SASI_Hs01_00085178 predicted 943
7 SASI_Hs01_00085179 predicted 1002
8 SASI_Hs01_00085180 predicted 998
9 SASI_Hs01_00085181 predicted 992
10 SASI_Hs02_00370099 predicted 786
11 SASI_Hs01_00085182 predicted 897
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109300 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247064 predicted 828
2 SASI_Rn02_00247065 predicted 955
3 SASI_Rn02_00247066 predicted 1266
4 SASI_Rn02_00247067 predicted 1218
5 SASI_Rn02_00247068 predicted 683
6 SASI_Rn02_00247069 predicted 749
7 SASI_Rn02_00247070 predicted 665
8 SASI_Rn02_00247071 predicted 1175
9 SASI_Rn02_00247072 predicted 1036
10 SASI_Rn02_00247073 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133978 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162617 predicted 483
2 SASI_Mm01_00162618 predicted 460
3 SASI_Mm01_00162619 predicted 249
4 SASI_Mm01_00162622 predicted 244
5 SASI_Mm01_00162623 predicted 491
6 SASI_Mm01_00162624 predicted 672
7 SASI_Mm01_00162625 predicted 417
8 SASI_Mm02_00339104 predicted 245
9 SASI_Mm02_00339105 predicted 326
10 SASI_Mm02_00339106 predicted 653
11 SASI_Mm01_00162620 predicted 384
12 SASI_Mm01_00162621 predicted 332
13 SASI_Mm01_00162626 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181472
VALIDATED
CMTM7 MISSION shRNA Bacterial Glycerol Stock
CKLF-like MARVEL transmembrane domain containing 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181472.1-452s1c1
Sequence:CCGGCGCCTACAGCTACTTTGAAGTCTCGAGACTTCAAAGTAGCTGTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181472.1-390s1c1
Sequence:CCGGCAAATGGTCACCCTGCTGATTCTCGAGAATCAGCAGGGTGACCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_181472.1-474s1c1
Sequence:CCGGGTCACCATTTGCGACTTGATACTCGAGTATCAAGTCGCAAATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_181472.1-1061s1c1
Sequence:CCGGCCTGTCCTAATTTATCTAGCTCTCGAGAGCTAGATAAATTAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134060    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181472.1-1055s1c1
Sequence:CCGGCAAAGCCCTGTCCTAATTTATCTCGAGATAAATTAGGACAGGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181472.1-563s1c1
Sequence:CCGGCCTGTCGATCTTTGGTTTCATCTCGAGATGAAACCAAAGATCGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_181472.1-474s21c1
Sequence:CCGGGTCACCATTTGCGACTTGATACTCGAGTATCAAGTCGCAAATGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_181472.1-375s21c1
Sequence:CCGGCTGCTGAAAGTGGCGCAAATGCTCGAGCATTTGCGCCACTTTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181472.1-452s21c1
Sequence:CCGGCGCCTACAGCTACTTTGAAGTCTCGAGACTTCAAAGTAGCTGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_181472.1-1061s21c1
Sequence:CCGGCCTGTCCTAATTTATCTAGCTCTCGAGAGCTAGATAAATTAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181472
VALIDATED
CMTM7 MISSION shRNA shRNA Plasmid DNA
CKLF-like MARVEL transmembrane domain containing 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181472.1-452s1c1
Sequence:CCGGCGCCTACAGCTACTTTGAAGTCTCGAGACTTCAAAGTAGCTGTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181472.1-390s1c1
Sequence:CCGGCAAATGGTCACCCTGCTGATTCTCGAGAATCAGCAGGGTGACCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_181472.1-474s1c1
Sequence:CCGGGTCACCATTTGCGACTTGATACTCGAGTATCAAGTCGCAAATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_181472.1-1061s1c1
Sequence:CCGGCCTGTCCTAATTTATCTAGCTCTCGAGAGCTAGATAAATTAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134060    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181472.1-1055s1c1
Sequence:CCGGCAAAGCCCTGTCCTAATTTATCTCGAGATAAATTAGGACAGGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181472.1-563s1c1
Sequence:CCGGCCTGTCGATCTTTGGTTTCATCTCGAGATGAAACCAAAGATCGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_181472.1-474s21c1
Sequence:CCGGGTCACCATTTGCGACTTGATACTCGAGTATCAAGTCGCAAATGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_181472.1-375s21c1
Sequence:CCGGCTGCTGAAAGTGGCGCAAATGCTCGAGCATTTGCGCCACTTTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181472.1-452s21c1
Sequence:CCGGCGCCTACAGCTACTTTGAAGTCTCGAGACTTCAAAGTAGCTGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_181472.1-1061s21c1
Sequence:CCGGCCTGTCCTAATTTATCTAGCTCTCGAGAGCTAGATAAATTAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181472
VALIDATED
CMTM7 MISSION shRNA Lentiviral Transduction Particles
CKLF-like MARVEL transmembrane domain containing 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181472.1-452s1c1
Sequence:CCGGCGCCTACAGCTACTTTGAAGTCTCGAGACTTCAAAGTAGCTGTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181472.1-390s1c1
Sequence:CCGGCAAATGGTCACCCTGCTGATTCTCGAGAATCAGCAGGGTGACCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_181472.1-474s1c1
Sequence:CCGGGTCACCATTTGCGACTTGATACTCGAGTATCAAGTCGCAAATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_181472.1-1061s1c1
Sequence:CCGGCCTGTCCTAATTTATCTAGCTCTCGAGAGCTAGATAAATTAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134060    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181472.1-1055s1c1
Sequence:CCGGCAAAGCCCTGTCCTAATTTATCTCGAGATAAATTAGGACAGGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181472.1-563s1c1
Sequence:CCGGCCTGTCGATCTTTGGTTTCATCTCGAGATGAAACCAAAGATCGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_181472.1-474s21c1
Sequence:CCGGGTCACCATTTGCGACTTGATACTCGAGTATCAAGTCGCAAATGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_181472.1-375s21c1
Sequence:CCGGCTGCTGAAAGTGGCGCAAATGCTCGAGCATTTGCGCCACTTTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181472.1-452s21c1
Sequence:CCGGCGCCTACAGCTACTTTGAAGTCTCGAGACTTCAAAGTAGCTGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_181472.1-1061s21c1
Sequence:CCGGCCTGTCCTAATTTATCTAGCTCTCGAGAGCTAGATAAATTAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133978
VALIDATED
CMTM7 MISSION shRNA Bacterial Glycerol Stock
CKLF-like MARVEL transmembrane domain containing 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133978.1-255s1c1
Sequence:CCGGCCTGATAATGATCCTCATCTTCTCGAGAAGATGAGGATCATTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133978.1-819s1c1
Sequence:CCGGGCCTGTCAATCTGGTCTTGAACTCGAGTTCAAGACCAGATTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133978.1-494s1c1
Sequence:CCGGTCACCTGTATAACCCAGTCTTCTCGAGAAGACTGGGTTATACAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133978.1-383s1c1
Sequence:CCGGCCATAGTGATAGCCTCCAAGACTCGAGTCTTGGAGGCTATCACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133978.1-345s1c1
Sequence:CCGGGCACTATTTAATCGGCACGCTCTCGAGAGCGTGCCGATTAAATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133978
VALIDATED
CMTM7 MISSION shRNA shRNA Plasmid DNA
CKLF-like MARVEL transmembrane domain containing 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133978.1-255s1c1
Sequence:CCGGCCTGATAATGATCCTCATCTTCTCGAGAAGATGAGGATCATTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133978.1-819s1c1
Sequence:CCGGGCCTGTCAATCTGGTCTTGAACTCGAGTTCAAGACCAGATTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133978.1-494s1c1
Sequence:CCGGTCACCTGTATAACCCAGTCTTCTCGAGAAGACTGGGTTATACAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133978.1-383s1c1
Sequence:CCGGCCATAGTGATAGCCTCCAAGACTCGAGTCTTGGAGGCTATCACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133978.1-345s1c1
Sequence:CCGGGCACTATTTAATCGGCACGCTCTCGAGAGCGTGCCGATTAAATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133978
VALIDATED
CMTM7 MISSION shRNA Lentiviral Transduction Particles
CKLF-like MARVEL transmembrane domain containing 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133978.1-255s1c1
Sequence:CCGGCCTGATAATGATCCTCATCTTCTCGAGAAGATGAGGATCATTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133978.1-819s1c1
Sequence:CCGGGCCTGTCAATCTGGTCTTGAACTCGAGTTCAAGACCAGATTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133978.1-494s1c1
Sequence:CCGGTCACCTGTATAACCCAGTCTTCTCGAGAAGACTGGGTTATACAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133978.1-383s1c1
Sequence:CCGGCCATAGTGATAGCCTCCAAGACTCGAGTCTTGGAGGCTATCACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133978.1-345s1c1
Sequence:CCGGGCACTATTTAATCGGCACGCTCTCGAGAGCGTGCCGATTAAATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks