EMAIL THIS PAGE TO A FRIEND

CMTM8

CKLF-like MARVEL transmembrane domain containing 8

60 Gene Product Result for
Synonyms: CKLFSF8 CKLFSF8-V2
UniProtKB ID: Q8IZV2, A5D6I7, Q8IW01
Gene ID:
Human(152189) Summary: This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and the transmembrane 4 superfamilies. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 3. This gene is widely expressed in many tissues, but the exact function of the encoded protein is unknown. [provided by RefSeq, Jul 2008]
Mouse(70031) CKLF-like MARVEL transmembrane domain containing 8
Rat(301045) CKLF-like MARVEL transmembrane domain containing 8
chicken(420665) CKLF-like MARVEL transmembrane domain containing 8
dog(485625) CKLF-like MARVEL transmembrane domain containing 8
cow(533671) CKLF-like MARVEL transmembrane domain containing 8
domestic cat(101080994) CKLF-like MARVEL transmembrane domain containing 8
naked mole-rat(101708708) CKLF-like MARVEL transmembrane domain containing 8
domestic guinea pig(100718002) CKLF-like MARVEL transmembrane domain containing 8
sheep(101111667) CKLF-like MARVEL transmembrane domain containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178868 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178868 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178868 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027294 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027294 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027294 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178868 Rosetta Predictions human pricing
NM_198754 Rosetta Predictions rat pricing
NM_027294 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215747 predicted 492
2 SASI_Hs01_00215748 predicted 502
3 SASI_Hs01_00215749 predicted 505
4 SASI_Hs01_00215750 predicted 614
5 SASI_Hs01_00215751 predicted 505
6 SASI_Hs01_00215752 predicted 495
7 SASI_Hs01_00215753 predicted 605
8 SASI_Hs01_00215754 predicted 607
9 SASI_Hs01_00215755 predicted 458
10 SASI_Hs01_00215756 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198754 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051737 predicted 815
2 SASI_Rn01_00051738 predicted 898
3 SASI_Rn01_00051739 predicted 860
4 SASI_Rn01_00051740 predicted 485
5 SASI_Rn01_00051741 predicted 395
6 SASI_Rn01_00051742 predicted 869
7 SASI_Rn01_00051744 predicted 501
8 SASI_Rn01_00051745 predicted 802
9 SASI_Rn01_00051746 predicted 735
10 SASI_Rn02_00269983 predicted 873
11 SASI_Rn01_00051743 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027294 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183225 predicted 308
2 SASI_Mm01_00183226 predicted 312
3 SASI_Mm01_00183227 predicted 558
4 SASI_Mm01_00183228 predicted 534
5 SASI_Mm01_00183229 predicted 530
6 SASI_Mm01_00183230 predicted 355
7 SASI_Mm01_00183231 predicted 390
8 SASI_Mm01_00183232 predicted 379
9 SASI_Mm02_00331899 predicted 575
10 SASI_Mm01_00183233 predicted 393
11 SASI_Mm01_00183234 predicted 348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178868
CMTM8 MISSION shRNA Bacterial Glycerol Stock
CKLF-like MARVEL transmembrane domain containing 8
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178868.3-500s21c1
Sequence:CCGGCATTTGGCTGGGTCATGTTTGCTCGAGCAAACATGACCCAGCCAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178868.3-543s21c1
Sequence:CCGGCACCGTCTTCTTCCTCATTATCTCGAGATAATGAGGAAGAAGACGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178868.3-801s21c1
Sequence:CCGGCAGGACCATACAGTGATTTACCTCGAGGTAAATCACTGTATGGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178868.3-452s21c1
Sequence:CCGGTGCTGGTATGGACGCTTATTGCTCGAGCAATAAGCGTCCATACCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178868.3-889s21c1
Sequence:CCGGATATTCCCAGAGAATTGTATTCTCGAGAATACAATTCTCTGGGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178868.3-541s1c1
Sequence:CCGGCTCACCGTCTTCTTCCTCATTCTCGAGAATGAGGAAGAAGACGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178868.3-462s1c1
Sequence:CCGGGACGCTTATTGCTGGAACTGACTCGAGTCAGTTCCAGCAATAAGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178868.3-659s1c1
Sequence:CCGGCCGCTGTTGTAGATGCATCTTCTCGAGAAGATGCATCTACAACAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178868.3-987s1c1
Sequence:CCGGGCAAAGTGTTGTAGCTTATAACTCGAGTTATAAGCTACAACACTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178868.3-943s1c1
Sequence:CCGGGCTCACAAATTGTGGTTTGTTCTCGAGAACAAACCACAATTTGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178868.3-758s1c1
Sequence:CCGGGCTACGCTGGAAATACATATTCTCGAGAATATGTATTTCCAGCGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178868.3-944s1c1
Sequence:CCGGCTCACAAATTGTGGTTTGTTACTCGAGTAACAAACCACAATTTGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178868
CMTM8 MISSION shRNA shRNA Plasmid DNA
CKLF-like MARVEL transmembrane domain containing 8
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178868.3-500s21c1
Sequence:CCGGCATTTGGCTGGGTCATGTTTGCTCGAGCAAACATGACCCAGCCAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178868.3-543s21c1
Sequence:CCGGCACCGTCTTCTTCCTCATTATCTCGAGATAATGAGGAAGAAGACGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178868.3-801s21c1
Sequence:CCGGCAGGACCATACAGTGATTTACCTCGAGGTAAATCACTGTATGGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178868.3-452s21c1
Sequence:CCGGTGCTGGTATGGACGCTTATTGCTCGAGCAATAAGCGTCCATACCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178868.3-889s21c1
Sequence:CCGGATATTCCCAGAGAATTGTATTCTCGAGAATACAATTCTCTGGGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178868.3-541s1c1
Sequence:CCGGCTCACCGTCTTCTTCCTCATTCTCGAGAATGAGGAAGAAGACGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178868.3-462s1c1
Sequence:CCGGGACGCTTATTGCTGGAACTGACTCGAGTCAGTTCCAGCAATAAGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178868.3-659s1c1
Sequence:CCGGCCGCTGTTGTAGATGCATCTTCTCGAGAAGATGCATCTACAACAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178868.3-987s1c1
Sequence:CCGGGCAAAGTGTTGTAGCTTATAACTCGAGTTATAAGCTACAACACTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178868.3-943s1c1
Sequence:CCGGGCTCACAAATTGTGGTTTGTTCTCGAGAACAAACCACAATTTGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178868.3-758s1c1
Sequence:CCGGGCTACGCTGGAAATACATATTCTCGAGAATATGTATTTCCAGCGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178868.3-944s1c1
Sequence:CCGGCTCACAAATTGTGGTTTGTTACTCGAGTAACAAACCACAATTTGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178868
CMTM8 MISSION shRNA Lentiviral Transduction Particles
CKLF-like MARVEL transmembrane domain containing 8
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178868.3-500s21c1
Sequence:CCGGCATTTGGCTGGGTCATGTTTGCTCGAGCAAACATGACCCAGCCAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178868.3-543s21c1
Sequence:CCGGCACCGTCTTCTTCCTCATTATCTCGAGATAATGAGGAAGAAGACGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178868.3-801s21c1
Sequence:CCGGCAGGACCATACAGTGATTTACCTCGAGGTAAATCACTGTATGGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178868.3-452s21c1
Sequence:CCGGTGCTGGTATGGACGCTTATTGCTCGAGCAATAAGCGTCCATACCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178868.3-889s21c1
Sequence:CCGGATATTCCCAGAGAATTGTATTCTCGAGAATACAATTCTCTGGGAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178868.3-541s1c1
Sequence:CCGGCTCACCGTCTTCTTCCTCATTCTCGAGAATGAGGAAGAAGACGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178868.3-462s1c1
Sequence:CCGGGACGCTTATTGCTGGAACTGACTCGAGTCAGTTCCAGCAATAAGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178868.3-659s1c1
Sequence:CCGGCCGCTGTTGTAGATGCATCTTCTCGAGAAGATGCATCTACAACAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178868.3-987s1c1
Sequence:CCGGGCAAAGTGTTGTAGCTTATAACTCGAGTTATAAGCTACAACACTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178868.3-943s1c1
Sequence:CCGGGCTCACAAATTGTGGTTTGTTCTCGAGAACAAACCACAATTTGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178868.3-758s1c1
Sequence:CCGGGCTACGCTGGAAATACATATTCTCGAGAATATGTATTTCCAGCGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178868.3-944s1c1
Sequence:CCGGCTCACAAATTGTGGTTTGTTACTCGAGTAACAAACCACAATTTGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027294
CMTM8 MISSION shRNA Bacterial Glycerol Stock
CKLF-like MARVEL transmembrane domain containing 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027294.1-783s1c1
Sequence:CCGGCCAGAACGAATCCCACTGTTACTCGAGTAACAGTGGGATTCGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027294.1-503s1c1
Sequence:CCGGACCCTGACTTACACCAGGATTCTCGAGAATCCTGGTGTAAGTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027294.1-691s1c1
Sequence:CCGGCTATGCTGGAAACACGTACTTCTCGAGAAGTACGTGTTTCCAGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027294.1-553s1c1
Sequence:CCGGGTGCTTTAATGGCAGTGCCTTCTCGAGAAGGCACTGCCATTAAAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027294.1-697s1c1
Sequence:CCGGTGGAAACACGTACTTCAGTTTCTCGAGAAACTGAAGTACGTGTTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027294
CMTM8 MISSION shRNA shRNA Plasmid DNA
CKLF-like MARVEL transmembrane domain containing 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027294.1-783s1c1
Sequence:CCGGCCAGAACGAATCCCACTGTTACTCGAGTAACAGTGGGATTCGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027294.1-503s1c1
Sequence:CCGGACCCTGACTTACACCAGGATTCTCGAGAATCCTGGTGTAAGTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027294.1-691s1c1
Sequence:CCGGCTATGCTGGAAACACGTACTTCTCGAGAAGTACGTGTTTCCAGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027294.1-553s1c1
Sequence:CCGGGTGCTTTAATGGCAGTGCCTTCTCGAGAAGGCACTGCCATTAAAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027294.1-697s1c1
Sequence:CCGGTGGAAACACGTACTTCAGTTTCTCGAGAAACTGAAGTACGTGTTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027294
CMTM8 MISSION shRNA Lentiviral Transduction Particles
CKLF-like MARVEL transmembrane domain containing 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027294.1-783s1c1
Sequence:CCGGCCAGAACGAATCCCACTGTTACTCGAGTAACAGTGGGATTCGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027294.1-503s1c1
Sequence:CCGGACCCTGACTTACACCAGGATTCTCGAGAATCCTGGTGTAAGTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027294.1-691s1c1
Sequence:CCGGCTATGCTGGAAACACGTACTTCTCGAGAAGTACGTGTTTCCAGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027294.1-553s1c1
Sequence:CCGGGTGCTTTAATGGCAGTGCCTTCTCGAGAAGGCACTGCCATTAAAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027294.1-697s1c1
Sequence:CCGGTGGAAACACGTACTTCAGTTTCTCGAGAAACTGAAGTACGTGTTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)