EMAIL THIS PAGE TO A FRIEND

CMTR1

cap methyltransferase 1

88 Gene Product Result for
Synonyms: FTSJD2 KIAA0082 MTr1 hMTr1
Gene ID:
Mouse(74157) cap methyltransferase 1
Rat(309656) cap methyltransferase 1
Zebrafish(393102) cap methyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015050 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015050 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015050 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015050 Rosetta Predictions human pricing
NM_001014031 Rosetta Predictions rat pricing
NM_028791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119935 predicted 1893
2 SASI_Hs01_00119936 predicted 327
3 SASI_Hs02_00346895 predicted 746
4 SASI_Hs01_00119937 predicted 849
5 SASI_Hs01_00119938 predicted 2180
6 SASI_Hs01_00119940 predicted 2162
7 SASI_Hs01_00119941 predicted 1043
8 SASI_Hs01_00119942 predicted 273
9 SASI_Hs02_00346896 predicted 1142
10 SASI_Hs01_00119943 predicted 288
11 SASI_Hs01_00119939 predicted 1165
12 SASI_Hs01_00119944 predicted 2064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099209 predicted 2004
2 SASI_Rn01_00099210 predicted 1024
3 SASI_Rn01_00099212 predicted 883
4 SASI_Rn01_00099213 predicted 2118
5 SASI_Rn02_00201413 predicted 2386
6 SASI_Rn01_00099214 predicted 2596
7 SASI_Rn01_00099216 predicted 570
8 SASI_Rn01_00099217 predicted 2543
9 SASI_Rn01_00099218 predicted 1104
10 SASI_Rn02_00201414 predicted 1625
11 SASI_Rn01_00099211 predicted 823
12 SASI_Rn01_00099215 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052380 predicted 2448
2 SASI_Mm01_00052381 predicted 777
3 SASI_Mm01_00052382 predicted 1034
4 SASI_Mm01_00052383 predicted 2504
5 SASI_Mm01_00052384 predicted 966
6 SASI_Mm01_00052385 predicted 2768
7 SASI_Mm01_00052386 predicted 208
8 SASI_Mm01_00052387 predicted 2620
9 SASI_Mm02_00334399 predicted 649
10 SASI_Mm01_00052388 predicted 2698
11 SASI_Mm01_00052379 predicted 272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028791
VALIDATED
CMTR1 MISSION shRNA Bacterial Glycerol Stock
cap methyltransferase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028791.3-1654s1c1
Sequence:CCGGGACTACATGATACGCTCTAATCTCGAGATTAGAGCGTATCATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028791.3-2700s1c1
Sequence:CCGGCCTGATGAATGTCCTGTCATTCTCGAGAATGACAGGACATTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028791.3-1189s1c1
Sequence:CCGGCCAGAGAACATCAATGCATTTCTCGAGAAATGCATTGATGTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028791.5-1653s21c1
Sequence:CCGGGACTACATGATACGCTCTAATCTCGAGATTAGAGCGTATCATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028791.5-1196s21c1
Sequence:CCGGCATCAATGCATTTCGGAATTTCTCGAGAAATTCCGAAATGCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028791.5-2418s21c1
Sequence:CCGGTACATTGTCAGGACCGTAAATCTCGAGATTTACGGTCCTGACAATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028791.5-479s21c1
Sequence:CCGGAGGCGAGGGATTGGGTAAATACTCGAGTATTTACCCAATCCCTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028791.5-3181s21c1
Sequence:CCGGGCTTTGGGTACTGGGTATAATCTCGAGATTATACCCAGTACCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028791
VALIDATED
CMTR1 MISSION shRNA shRNA Plasmid DNA
cap methyltransferase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028791.3-1654s1c1
Sequence:CCGGGACTACATGATACGCTCTAATCTCGAGATTAGAGCGTATCATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028791.3-2700s1c1
Sequence:CCGGCCTGATGAATGTCCTGTCATTCTCGAGAATGACAGGACATTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028791.3-1189s1c1
Sequence:CCGGCCAGAGAACATCAATGCATTTCTCGAGAAATGCATTGATGTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028791.5-1653s21c1
Sequence:CCGGGACTACATGATACGCTCTAATCTCGAGATTAGAGCGTATCATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028791.5-1196s21c1
Sequence:CCGGCATCAATGCATTTCGGAATTTCTCGAGAAATTCCGAAATGCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028791.5-2418s21c1
Sequence:CCGGTACATTGTCAGGACCGTAAATCTCGAGATTTACGGTCCTGACAATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028791.5-479s21c1
Sequence:CCGGAGGCGAGGGATTGGGTAAATACTCGAGTATTTACCCAATCCCTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028791.5-3181s21c1
Sequence:CCGGGCTTTGGGTACTGGGTATAATCTCGAGATTATACCCAGTACCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028791
VALIDATED
CMTR1 MISSION shRNA Lentiviral Transduction Particles
cap methyltransferase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028791.3-1654s1c1
Sequence:CCGGGACTACATGATACGCTCTAATCTCGAGATTAGAGCGTATCATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028791.3-2700s1c1
Sequence:CCGGCCTGATGAATGTCCTGTCATTCTCGAGAATGACAGGACATTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028791.3-1189s1c1
Sequence:CCGGCCAGAGAACATCAATGCATTTCTCGAGAAATGCATTGATGTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028791.5-1653s21c1
Sequence:CCGGGACTACATGATACGCTCTAATCTCGAGATTAGAGCGTATCATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028791.5-1196s21c1
Sequence:CCGGCATCAATGCATTTCGGAATTTCTCGAGAAATTCCGAAATGCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028791.5-2418s21c1
Sequence:CCGGTACATTGTCAGGACCGTAAATCTCGAGATTTACGGTCCTGACAATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028791.5-479s21c1
Sequence:CCGGAGGCGAGGGATTGGGTAAATACTCGAGTATTTACCCAATCCCTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028791.5-3181s21c1
Sequence:CCGGGCTTTGGGTACTGGGTATAATCTCGAGATTATACCCAGTACCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015050
VALIDATED
CMTR1 MISSION shRNA Bacterial Glycerol Stock
cap methyltransferase 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_015050.1-1502s1c1
Sequence:CCGGGCATAGATGATGTTCGGGATTCTCGAGAATCCCGAACATCATCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015050.1-747s1c1
Sequence:CCGGGCAGTGTAAGAGCGTGTTTGACTCGAGTCAAACACGCTCTTACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015050.1-3122s1c1
Sequence:CCGGGCCAGGAGAACCTGCTATAAACTCGAGTTTATAGCAGGTTCTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015050.1-3654s1c1
Sequence:CCGGCGTTAAGTGGTCACTCCCATTCTCGAGAATGGGAGTGACCACTTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015050.1-2166s1c1
Sequence:CCGGGCAGCACTTTAACCAGCGAATCTCGAGATTCGCTGGTTAAAGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_015050.1-1026s1c1
Sequence:CCGGGCATGCAAAGGGCTTTGGAATCTCGAGATTCCAAAGCCCTTTGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_015050.1-3181s1c1
Sequence:CCGGGATGCCAAATTGGAGACCATTCTCGAGAATGGTCTCCAATTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015050.1-1031s1c1
Sequence:CCGGCAAAGGGCTTTGGAATGACTTCTCGAGAAGTCATTCCAAAGCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015050.1-1803s1c1
Sequence:CCGGCGACCCTAAATCGAAGTTCTTCTCGAGAAGAACTTCGATTTAGGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015050.2-3229s21c1
Sequence:CCGGGCCAGGAGAACCTGCTATAAACTCGAGTTTATAGCAGGTTCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015050.2-1608s21c1
Sequence:CCGGGCATAGATGATGTTCGGGATTCTCGAGAATCCCGAACATCATCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015050.2-3761s21c1
Sequence:CCGGCGTTAAGTGGTCACTCCCATTCTCGAGAATGGGAGTGACCACTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015050.2-3288s21c1
Sequence:CCGGGATGCCAAATTGGAGACCATTCTCGAGAATGGTCTCCAATTTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015050.2-1132s21c1
Sequence:CCGGGCATGCAAAGGGCTTTGGAATCTCGAGATTCCAAAGCCCTTTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015050
VALIDATED
CMTR1 MISSION shRNA shRNA Plasmid DNA
cap methyltransferase 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_015050.1-1502s1c1
Sequence:CCGGGCATAGATGATGTTCGGGATTCTCGAGAATCCCGAACATCATCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015050.1-747s1c1
Sequence:CCGGGCAGTGTAAGAGCGTGTTTGACTCGAGTCAAACACGCTCTTACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015050.1-3122s1c1
Sequence:CCGGGCCAGGAGAACCTGCTATAAACTCGAGTTTATAGCAGGTTCTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015050.1-3654s1c1
Sequence:CCGGCGTTAAGTGGTCACTCCCATTCTCGAGAATGGGAGTGACCACTTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015050.1-2166s1c1
Sequence:CCGGGCAGCACTTTAACCAGCGAATCTCGAGATTCGCTGGTTAAAGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_015050.1-1026s1c1
Sequence:CCGGGCATGCAAAGGGCTTTGGAATCTCGAGATTCCAAAGCCCTTTGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_015050.1-3181s1c1
Sequence:CCGGGATGCCAAATTGGAGACCATTCTCGAGAATGGTCTCCAATTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015050.1-1031s1c1
Sequence:CCGGCAAAGGGCTTTGGAATGACTTCTCGAGAAGTCATTCCAAAGCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015050.1-1803s1c1
Sequence:CCGGCGACCCTAAATCGAAGTTCTTCTCGAGAAGAACTTCGATTTAGGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015050.2-3229s21c1
Sequence:CCGGGCCAGGAGAACCTGCTATAAACTCGAGTTTATAGCAGGTTCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015050.2-1608s21c1
Sequence:CCGGGCATAGATGATGTTCGGGATTCTCGAGAATCCCGAACATCATCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015050.2-3761s21c1
Sequence:CCGGCGTTAAGTGGTCACTCCCATTCTCGAGAATGGGAGTGACCACTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015050.2-3288s21c1
Sequence:CCGGGATGCCAAATTGGAGACCATTCTCGAGAATGGTCTCCAATTTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015050.2-1132s21c1
Sequence:CCGGGCATGCAAAGGGCTTTGGAATCTCGAGATTCCAAAGCCCTTTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015050
VALIDATED
CMTR1 MISSION shRNA Lentiviral Transduction Particles
cap methyltransferase 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_015050.1-1502s1c1
Sequence:CCGGGCATAGATGATGTTCGGGATTCTCGAGAATCCCGAACATCATCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015050.1-747s1c1
Sequence:CCGGGCAGTGTAAGAGCGTGTTTGACTCGAGTCAAACACGCTCTTACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015050.1-3122s1c1
Sequence:CCGGGCCAGGAGAACCTGCTATAAACTCGAGTTTATAGCAGGTTCTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015050.1-3654s1c1
Sequence:CCGGCGTTAAGTGGTCACTCCCATTCTCGAGAATGGGAGTGACCACTTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015050.1-2166s1c1
Sequence:CCGGGCAGCACTTTAACCAGCGAATCTCGAGATTCGCTGGTTAAAGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_015050.1-1026s1c1
Sequence:CCGGGCATGCAAAGGGCTTTGGAATCTCGAGATTCCAAAGCCCTTTGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_015050.1-3181s1c1
Sequence:CCGGGATGCCAAATTGGAGACCATTCTCGAGAATGGTCTCCAATTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015050.1-1031s1c1
Sequence:CCGGCAAAGGGCTTTGGAATGACTTCTCGAGAAGTCATTCCAAAGCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015050.1-1803s1c1
Sequence:CCGGCGACCCTAAATCGAAGTTCTTCTCGAGAAGAACTTCGATTTAGGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015050.2-3229s21c1
Sequence:CCGGGCCAGGAGAACCTGCTATAAACTCGAGTTTATAGCAGGTTCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015050.2-1608s21c1
Sequence:CCGGGCATAGATGATGTTCGGGATTCTCGAGAATCCCGAACATCATCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015050.2-3761s21c1
Sequence:CCGGCGTTAAGTGGTCACTCCCATTCTCGAGAATGGGAGTGACCACTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015050.2-3288s21c1
Sequence:CCGGGATGCCAAATTGGAGACCATTCTCGAGAATGGTCTCCAATTTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015050.2-1132s21c1
Sequence:CCGGGCATGCAAAGGGCTTTGGAATCTCGAGATTCCAAAGCCCTTTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks