EMAIL THIS PAGE TO A FRIEND

CMTR2

cap methyltransferase 2

63 Gene Product Result for
Synonyms: AFT FTSJD1 MTr2
Gene ID:
Mouse(234728) cap methyltransferase 2
Rat(292016) cap methyltransferase 2
Zebrafish(406742) cap methyltransferase 2
cow(781914) cap methyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018348 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146215 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146215 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146215 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099642 Rosetta Predictions human pricing
NM_018348 Rosetta Predictions human pricing
NM_001106186 Rosetta Predictions rat pricing
NM_146215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320843 predicted 2367
2 SASI_Hs02_00320844 predicted 969
3 SASI_Hs02_00320845 predicted 1862
4 SASI_Hs02_00320846 predicted 1012
5 SASI_Hs02_00320847 predicted 2254
6 SASI_Hs02_00320848 predicted 1340
7 SASI_Hs02_00320849 predicted 766
8 SASI_Hs02_00320850 predicted 2305
9 SASI_Hs02_00320851 predicted 2511
10 SASI_Hs02_00320852 predicted 1958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351800 predicted 2511
2 SASI_Hs01_00176680 predicted 1115
3 SASI_Hs01_00176682 predicted 2004
4 SASI_Hs01_00176683 predicted 1155
5 SASI_Hs01_00176684 predicted 2400
6 SASI_Hs01_00176685 predicted 1491
7 SASI_Hs02_00351801 predicted 911
8 SASI_Hs02_00351802 predicted 2455
9 SASI_Hs01_00176686 predicted 2661
10 SASI_Hs02_00351803 predicted 2095
11 SASI_Hs01_00176681 predicted 1716
12 SASI_Hs01_00176687 predicted 454
13 SASI_Hs01_00176688 predicted 579
14 SASI_Hs01_00176689 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216478 predicted 1340
2 SASI_Rn02_00216479 predicted 760
3 SASI_Rn02_00216480 predicted 744
4 SASI_Rn02_00216481 predicted 1638
5 SASI_Rn02_00216482 predicted 1000
6 SASI_Rn02_00216483 predicted 1960
7 SASI_Rn02_00216484 predicted 1773
8 SASI_Rn02_00216485 predicted 2385
9 SASI_Rn02_00216486 predicted 481
10 SASI_Rn02_00216487 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341915 predicted 660
2 SASI_Mm01_00133884 predicted 2453
3 SASI_Mm01_00133885 predicted 1611
4 SASI_Mm01_00133886 predicted 1206
5 SASI_Mm01_00133887 predicted 1172
6 SASI_Mm01_00133888 predicted 725
7 SASI_Mm01_00133889 predicted 347
8 SASI_Mm01_00133890 predicted 633
9 SASI_Mm01_00133891 predicted 1772
10 SASI_Mm01_00133892 predicted 800
11 SASI_Mm01_00133883 predicted 2494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018348
VALIDATED
CMTR2 MISSION shRNA Bacterial Glycerol Stock
cap methyltransferase 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018348.5-1657s21c1
Sequence:CCGGATATCAGCTAGAGACTATTTCCTCGAGGAAATAGTCTCTAGCTGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018348.5-2407s21c1
Sequence:CCGGTCCAACTTACCAGCGTTTATTCTCGAGAATAAACGCTGGTAAGTTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018348.5-2019s21c1
Sequence:CCGGAGTGTCACTTATGGCATATTTCTCGAGAAATATGCCATAAGTGACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018348.4-2762s1c1
Sequence:CCGGGCATCATTCAAAGTCTCATTACTCGAGTAATGAGACTTTGAATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018348.4-530s1c1
Sequence:CCGGGATTTGAAGAACTCCCTAAATCTCGAGATTTAGGGAGTTCTTCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018348.4-395s1c1
Sequence:CCGGCCAGATATTCTTGCTGACATTCTCGAGAATGTCAGCAAGAATATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018348.4-1259s1c1
Sequence:CCGGGCAGGAAACTCCGAAGTCTATCTCGAGATAGACTTCGGAGTTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018348
VALIDATED
CMTR2 MISSION shRNA shRNA Plasmid DNA
cap methyltransferase 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018348.5-1657s21c1
Sequence:CCGGATATCAGCTAGAGACTATTTCCTCGAGGAAATAGTCTCTAGCTGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018348.5-2407s21c1
Sequence:CCGGTCCAACTTACCAGCGTTTATTCTCGAGAATAAACGCTGGTAAGTTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018348.5-2019s21c1
Sequence:CCGGAGTGTCACTTATGGCATATTTCTCGAGAAATATGCCATAAGTGACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018348.4-2762s1c1
Sequence:CCGGGCATCATTCAAAGTCTCATTACTCGAGTAATGAGACTTTGAATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018348.4-530s1c1
Sequence:CCGGGATTTGAAGAACTCCCTAAATCTCGAGATTTAGGGAGTTCTTCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018348.4-395s1c1
Sequence:CCGGCCAGATATTCTTGCTGACATTCTCGAGAATGTCAGCAAGAATATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018348.4-1259s1c1
Sequence:CCGGGCAGGAAACTCCGAAGTCTATCTCGAGATAGACTTCGGAGTTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018348
VALIDATED
CMTR2 MISSION shRNA Lentiviral Transduction Particles
cap methyltransferase 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018348.5-1657s21c1
Sequence:CCGGATATCAGCTAGAGACTATTTCCTCGAGGAAATAGTCTCTAGCTGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018348.5-2407s21c1
Sequence:CCGGTCCAACTTACCAGCGTTTATTCTCGAGAATAAACGCTGGTAAGTTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018348.5-2019s21c1
Sequence:CCGGAGTGTCACTTATGGCATATTTCTCGAGAAATATGCCATAAGTGACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018348.4-2762s1c1
Sequence:CCGGGCATCATTCAAAGTCTCATTACTCGAGTAATGAGACTTTGAATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018348.4-530s1c1
Sequence:CCGGGATTTGAAGAACTCCCTAAATCTCGAGATTTAGGGAGTTCTTCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018348.4-395s1c1
Sequence:CCGGCCAGATATTCTTGCTGACATTCTCGAGAATGTCAGCAAGAATATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018348.4-1259s1c1
Sequence:CCGGGCAGGAAACTCCGAAGTCTATCTCGAGATAGACTTCGGAGTTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146215
VALIDATED
CMTR2 MISSION shRNA Bacterial Glycerol Stock
cap methyltransferase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146215.3-2623s21c1
Sequence:CCGGGCCGTGTACTGATGGTATTTACTCGAGTAAATACCATCAGTACACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146215.3-1225s21c1
Sequence:CCGGATACCAGTTAGAGACTATATCCTCGAGGATATAGTCTCTAACTGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146215.3-573s21c1
Sequence:CCGGCTAGCCTCAACCATTACTTAACTCGAGTTAAGTAATGGTTGAGGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146215.3-224s21c1
Sequence:CCGGTACCGTAAGCCACTCGATAATCTCGAGATTATCGAGTGGCTTACGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146215.3-2173s21c1
Sequence:CCGGGCTGTGCATTGGTTATCAGAACTCGAGTTCTGATAACCAATGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146215.2-1411s1c1
Sequence:CCGGCGAAATGGTTTGGACAGAGAACTCGAGTTCTCTGTCCAAACCATTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146215.2-2174s1c1
Sequence:CCGGGCTGTGCATTGGTTATCAGAACTCGAGTTCTGATAACCAATGCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146215.2-727s1c1
Sequence:CCGGGCCCAGATAATACCGGTGATACTCGAGTATCACCGGTATTATCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146215.2-3357s1c1
Sequence:CCGGCCAAGGTGTTTATTTGTCATTCTCGAGAATGACAAATAAACACCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146215
VALIDATED
CMTR2 MISSION shRNA shRNA Plasmid DNA
cap methyltransferase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146215.3-2623s21c1
Sequence:CCGGGCCGTGTACTGATGGTATTTACTCGAGTAAATACCATCAGTACACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146215.3-1225s21c1
Sequence:CCGGATACCAGTTAGAGACTATATCCTCGAGGATATAGTCTCTAACTGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146215.3-573s21c1
Sequence:CCGGCTAGCCTCAACCATTACTTAACTCGAGTTAAGTAATGGTTGAGGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146215.3-224s21c1
Sequence:CCGGTACCGTAAGCCACTCGATAATCTCGAGATTATCGAGTGGCTTACGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146215.3-2173s21c1
Sequence:CCGGGCTGTGCATTGGTTATCAGAACTCGAGTTCTGATAACCAATGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146215.2-1411s1c1
Sequence:CCGGCGAAATGGTTTGGACAGAGAACTCGAGTTCTCTGTCCAAACCATTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146215.2-2174s1c1
Sequence:CCGGGCTGTGCATTGGTTATCAGAACTCGAGTTCTGATAACCAATGCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146215.2-727s1c1
Sequence:CCGGGCCCAGATAATACCGGTGATACTCGAGTATCACCGGTATTATCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146215.2-3357s1c1
Sequence:CCGGCCAAGGTGTTTATTTGTCATTCTCGAGAATGACAAATAAACACCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146215
VALIDATED
CMTR2 MISSION shRNA Lentiviral Transduction Particles
cap methyltransferase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146215.3-2623s21c1
Sequence:CCGGGCCGTGTACTGATGGTATTTACTCGAGTAAATACCATCAGTACACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146215.3-1225s21c1
Sequence:CCGGATACCAGTTAGAGACTATATCCTCGAGGATATAGTCTCTAACTGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146215.3-573s21c1
Sequence:CCGGCTAGCCTCAACCATTACTTAACTCGAGTTAAGTAATGGTTGAGGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146215.3-224s21c1
Sequence:CCGGTACCGTAAGCCACTCGATAATCTCGAGATTATCGAGTGGCTTACGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146215.3-2173s21c1
Sequence:CCGGGCTGTGCATTGGTTATCAGAACTCGAGTTCTGATAACCAATGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146215.2-1411s1c1
Sequence:CCGGCGAAATGGTTTGGACAGAGAACTCGAGTTCTCTGTCCAAACCATTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146215.2-2174s1c1
Sequence:CCGGGCTGTGCATTGGTTATCAGAACTCGAGTTCTGATAACCAATGCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146215.2-727s1c1
Sequence:CCGGGCCCAGATAATACCGGTGATACTCGAGTATCACCGGTATTATCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146215.2-3357s1c1
Sequence:CCGGCCAAGGTGTTTATTTGTCATTCTCGAGAATGACAAATAAACACCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)