EMAIL THIS PAGE TO A FRIEND

CMYA5

cardiomyopathy associated 5

53 Gene Product Result for
Synonyms: C5orf10 SPRYD2 TRIM76
Gene ID:
Mouse(76469) cardiomyopathy associated 5
Rat(688915) cardiomyopathy associated 5
sheep(101109097) cardiomyopathy associated 5
domestic guinea pig(100725984) cardiomyopathy associated 5
naked mole-rat(101703140) cardiomyopathy associated 5
Zebrafish(560687) cardiomyopathy associated 5
domestic cat(101086535) cardiomyopathy associated 5
Horse(100073263) cardiomyopathy associated 5
dog(479170) cardiomyopathy associated 5
chicken(427177) cardiomyopathy associated 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500671 Anti-CMYA5 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153610 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023821 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023821 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023821 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153610 Rosetta Predictions human pricing
XM_001068814 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205100 predicted 5948
2 SASI_Hs02_00367341 predicted 7082
3 SASI_Hs02_00367342 predicted 7626
4 SASI_Hs01_00205103 predicted 7523
5 SASI_Hs02_00367343 predicted 4819
6 SASI_Hs01_00205105 predicted 702
7 SASI_Hs02_00367344 predicted 1678
8 SASI_Hs02_00367345 predicted 11506
9 SASI_Hs02_00367346 predicted 2221
10 SASI_Hs02_00367347 predicted 10756
11 SASI_Hs01_00205098 predicted 10346
12 SASI_Hs01_00205099 predicted 5517
13 SASI_Hs01_00205101 predicted 6768
14 SASI_Hs01_00205102 predicted 4992
15 SASI_Hs01_00205104 predicted 3730
16 SASI_Hs01_00205106 predicted 3720
17 SASI_Hs01_00205107 predicted 8706
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325964 predicted 5024
2 SASI_Rn02_00325965 predicted 4361
3 SASI_Rn02_00325966 predicted 6345
4 SASI_Rn02_00325967 predicted 10071
5 SASI_Rn02_00325968 predicted 6995
6 SASI_Rn02_00325969 predicted 504
7 SASI_Rn02_00325970 predicted 10588
8 SASI_Rn02_00325971 predicted 9074
9 SASI_Rn02_00325972 predicted 7460
10 SASI_Rn02_00325973 predicted 7379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153610
CMYA5 MISSION shRNA Bacterial Glycerol Stock
cardiomyopathy associated 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153610.2-3719s1c1
Sequence:CCGGGACTACAACAACCAGAGACTTCTCGAGAAGTCTCTGGTTGTTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153610.2-914s1c1
Sequence:CCGGGAAGAGAAACTCTCAAAGGAACTCGAGTTCCTTTGAGAGTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153610.2-3277s1c1
Sequence:CCGGCCAACCCAATGATAACTACTTCTCGAGAAGTAGTTATCATTGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153610.2-3060s1c1
Sequence:CCGGCCAGTGAAAGGGCCATCTTTACTCGAGTAAAGATGGCCCTTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153610.2-3760s1c1
Sequence:CCGGCGAGCAGTTGCTCTTCATCATCTCGAGATGATGAAGAGCAACTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153610.3-3134s21c1
Sequence:CCGGTTGAGCCTGATTCACTATTAACTCGAGTTAATAGTGAATCAGGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153610.3-3529s21c1
Sequence:GTACCGGTTACCTGCACAATCATCTATACTCGAGTATAGATGATTGTGCAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153610.3-12340s21c1
Sequence:CCGGTCATTCCTTTAGGTGCTATACCTCGAGGTATAGCACCTAAAGGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153610.3-11664s21c1
Sequence:CCGGTAACCTCCAACCCAATGATAACTCGAGTTATCATTGGGTTGGAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153610.3-9565s21c1
Sequence:CCGGCTATCACGAACCCAGATATTTCTCGAGAAATATCTGGGTTCGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153610
CMYA5 MISSION shRNA shRNA Plasmid DNA
cardiomyopathy associated 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153610.2-3719s1c1
Sequence:CCGGGACTACAACAACCAGAGACTTCTCGAGAAGTCTCTGGTTGTTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153610.2-914s1c1
Sequence:CCGGGAAGAGAAACTCTCAAAGGAACTCGAGTTCCTTTGAGAGTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153610.2-3277s1c1
Sequence:CCGGCCAACCCAATGATAACTACTTCTCGAGAAGTAGTTATCATTGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153610.2-3060s1c1
Sequence:CCGGCCAGTGAAAGGGCCATCTTTACTCGAGTAAAGATGGCCCTTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153610.2-3760s1c1
Sequence:CCGGCGAGCAGTTGCTCTTCATCATCTCGAGATGATGAAGAGCAACTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153610.3-3134s21c1
Sequence:CCGGTTGAGCCTGATTCACTATTAACTCGAGTTAATAGTGAATCAGGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153610.3-3529s21c1
Sequence:GTACCGGTTACCTGCACAATCATCTATACTCGAGTATAGATGATTGTGCAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153610.3-12340s21c1
Sequence:CCGGTCATTCCTTTAGGTGCTATACCTCGAGGTATAGCACCTAAAGGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153610.3-11664s21c1
Sequence:CCGGTAACCTCCAACCCAATGATAACTCGAGTTATCATTGGGTTGGAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153610.3-9565s21c1
Sequence:CCGGCTATCACGAACCCAGATATTTCTCGAGAAATATCTGGGTTCGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153610
CMYA5 MISSION shRNA Lentiviral Transduction Particles
cardiomyopathy associated 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153610.2-3719s1c1
Sequence:CCGGGACTACAACAACCAGAGACTTCTCGAGAAGTCTCTGGTTGTTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153610.2-914s1c1
Sequence:CCGGGAAGAGAAACTCTCAAAGGAACTCGAGTTCCTTTGAGAGTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153610.2-3277s1c1
Sequence:CCGGCCAACCCAATGATAACTACTTCTCGAGAAGTAGTTATCATTGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153610.2-3060s1c1
Sequence:CCGGCCAGTGAAAGGGCCATCTTTACTCGAGTAAAGATGGCCCTTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153610.2-3760s1c1
Sequence:CCGGCGAGCAGTTGCTCTTCATCATCTCGAGATGATGAAGAGCAACTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153610.3-3134s21c1
Sequence:CCGGTTGAGCCTGATTCACTATTAACTCGAGTTAATAGTGAATCAGGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153610.3-3529s21c1
Sequence:GTACCGGTTACCTGCACAATCATCTATACTCGAGTATAGATGATTGTGCAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153610.3-12340s21c1
Sequence:CCGGTCATTCCTTTAGGTGCTATACCTCGAGGTATAGCACCTAAAGGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153610.3-11664s21c1
Sequence:CCGGTAACCTCCAACCCAATGATAACTCGAGTTATCATTGGGTTGGAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153610.3-9565s21c1
Sequence:CCGGCTATCACGAACCCAGATATTTCTCGAGAAATATCTGGGTTCGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023821
CMYA5 MISSION shRNA Bacterial Glycerol Stock
cardiomyopathy associated 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-6131s21c1
Sequence:CCGGATTACCTGAGGTCACAGTTAACTCGAGTTAACTGTGACCTCAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-5032s21c1
Sequence:CCGGCAGGAGAGCAAGAGCTTATAACTCGAGTTATAAGCTCTTGCTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-10614s21c1
Sequence:CCGGGGACTCCAGCTCAAGGTTAACCTCGAGGTTAACCTTGAGCTGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023821.3-11653s21c1
Sequence:CCGGTTACTTCACTAGAGGATAATGCTCGAGCATTATCCTCTAGTGAAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-6085s21c1
Sequence:CCGGCAGTTCCTGCTGAGGTTAATACTCGAGTATTAACCTCAGCAGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-8204s21c1
Sequence:CCGGTTCTGGTGAAGAGGATTATTTCTCGAGAAATAATCCTCTTCACCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-3610s21c1
Sequence:CCGGAGGTCGAGCCAGACGAATTACCTCGAGGTAATTCGTCTGGCTCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-4763s21c1
Sequence:CCGGGTCTACCTCAGAGGTGTTAAGCTCGAGCTTAACACCTCTGAGGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023821
CMYA5 MISSION shRNA shRNA Plasmid DNA
cardiomyopathy associated 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-6131s21c1
Sequence:CCGGATTACCTGAGGTCACAGTTAACTCGAGTTAACTGTGACCTCAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-5032s21c1
Sequence:CCGGCAGGAGAGCAAGAGCTTATAACTCGAGTTATAAGCTCTTGCTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-10614s21c1
Sequence:CCGGGGACTCCAGCTCAAGGTTAACCTCGAGGTTAACCTTGAGCTGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023821.3-11653s21c1
Sequence:CCGGTTACTTCACTAGAGGATAATGCTCGAGCATTATCCTCTAGTGAAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-6085s21c1
Sequence:CCGGCAGTTCCTGCTGAGGTTAATACTCGAGTATTAACCTCAGCAGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-8204s21c1
Sequence:CCGGTTCTGGTGAAGAGGATTATTTCTCGAGAAATAATCCTCTTCACCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-3610s21c1
Sequence:CCGGAGGTCGAGCCAGACGAATTACCTCGAGGTAATTCGTCTGGCTCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-4763s21c1
Sequence:CCGGGTCTACCTCAGAGGTGTTAAGCTCGAGCTTAACACCTCTGAGGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023821
CMYA5 MISSION shRNA Lentiviral Transduction Particles
cardiomyopathy associated 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-6131s21c1
Sequence:CCGGATTACCTGAGGTCACAGTTAACTCGAGTTAACTGTGACCTCAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-5032s21c1
Sequence:CCGGCAGGAGAGCAAGAGCTTATAACTCGAGTTATAAGCTCTTGCTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-10614s21c1
Sequence:CCGGGGACTCCAGCTCAAGGTTAACCTCGAGGTTAACCTTGAGCTGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023821.3-11653s21c1
Sequence:CCGGTTACTTCACTAGAGGATAATGCTCGAGCATTATCCTCTAGTGAAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-6085s21c1
Sequence:CCGGCAGTTCCTGCTGAGGTTAATACTCGAGTATTAACCTCAGCAGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-8204s21c1
Sequence:CCGGTTCTGGTGAAGAGGATTATTTCTCGAGAAATAATCCTCTTCACCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-3610s21c1
Sequence:CCGGAGGTCGAGCCAGACGAATTACCTCGAGGTAATTCGTCTGGCTCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023821.3-4763s21c1
Sequence:CCGGGTCTACCTCAGAGGTGTTAAGCTCGAGCTTAACACCTCTGAGGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks