EMAIL THIS PAGE TO A FRIEND

CNBD1

cyclic nucleotide binding domain containing 1

53 Gene Product Result for
UniProtKB ID: Q8NA66
Gene ID:
Mouse(435772) cyclic nucleotide binding domain containing 1
Rat(689462) cyclic nucleotide binding domain containing 1
cow(787250) cyclic nucleotide binding domain containing 1
dog(611195) cyclic nucleotide binding domain containing 1
Horse(100055345) cyclic nucleotide binding domain containing 1
domestic cat(101099860) cyclic nucleotide binding domain containing 1
sheep(101112328) cyclic nucleotide binding domain containing 1
naked mole-rat(101712570) cyclic nucleotide binding domain containing 1
domestic guinea pig(100717241) cyclic nucleotide binding domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173538 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173538 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173538 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173538 Rosetta Predictions human pricing
XM_001070898 Rosetta Predictions rat pricing
XM_487784 Rosetta Predictions mouse pricing
XM_908723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040747 predicted 348
2 SASI_Hs01_00040752 predicted 900
3 SASI_Hs01_00040753 predicted 1161
4 SASI_Hs02_00368332 predicted 901
5 SASI_Hs01_00040754 predicted 1027
6 SASI_Hs01_00040755 predicted 479
7 SASI_Hs02_00368333 predicted 528
8 SASI_Hs01_00040756 predicted 784
9 SASI_Hs02_00368334 predicted 706
10 SASI_Hs02_00368335 predicted 789
11 SASI_Hs01_00040748 predicted 1341
12 SASI_Hs01_00040749 predicted 1000
13 SASI_Hs01_00040750 predicted 1288
14 SASI_Hs01_00040751 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333219 predicted 547
2 SASI_Rn02_00333220 predicted 241
3 SASI_Rn02_00333221 predicted 980
4 SASI_Rn02_00333222 predicted 1151
5 SASI_Rn02_00333223 predicted 650
6 SASI_Rn02_00333224 predicted 635
7 SASI_Rn02_00333225 predicted 507
8 SASI_Rn02_00333226 predicted 965
9 SASI_Rn02_00333227 predicted 867
10 SASI_Rn02_00333228 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_487784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426996 predicted 808
2 SASI_Mm02_00426997 predicted 310
3 SASI_Mm02_00426998 predicted 818
4 SASI_Mm02_00426999 predicted 835
5 SASI_Mm02_00427000 predicted 636
6 SASI_Mm02_00427001 predicted 663
7 SASI_Mm02_00427002 predicted 623
8 SASI_Mm02_00427003 predicted 826
9 SASI_Mm02_00427004 predicted 670
10 SASI_Mm02_00427005 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434335 predicted 812
2 SASI_Mm02_00434336 predicted 305
3 SASI_Mm02_00434337 predicted 818
4 SASI_Mm02_00434338 predicted 835
5 SASI_Mm02_00434339 predicted 629
6 SASI_Mm02_00434340 predicted 663
7 SASI_Mm02_00434341 predicted 623
8 SASI_Mm02_00434342 predicted 822
9 SASI_Mm02_00434343 predicted 678
10 SASI_Mm02_00434344 predicted 315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173538
CNBD1 MISSION shRNA Bacterial Glycerol Stock
cyclic nucleotide binding domain containing 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173538.2-1175s21c1
Sequence:CCGGTTGTGAAACTACGATCAAATACTCGAGTATTTGATCGTAGTTTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173538.2-81s21c1
Sequence:CCGGGTCTCACATGACAGCTATTAACTCGAGTTAATAGCTGTCATGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173538.1-210s1c1
Sequence:CCGGCCGGAGTATGAGCAATATCTTCTCGAGAAGATATTGCTCATACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173538.1-1268s1c1
Sequence:CCGGGCGTCCTTCTTCAAGTTCCTTCTCGAGAAGGAACTTGAAGAAGGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173538.1-676s1c1
Sequence:CCGGCCTCAAACAAACGTGTATAAACTCGAGTTTATACACGTTTGTTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173538.1-822s1c1
Sequence:CCGGGCTTAGCAAATGGAGTACCTTCTCGAGAAGGTACTCCATTTGCTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173538
CNBD1 MISSION shRNA shRNA Plasmid DNA
cyclic nucleotide binding domain containing 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173538.2-1175s21c1
Sequence:CCGGTTGTGAAACTACGATCAAATACTCGAGTATTTGATCGTAGTTTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173538.2-81s21c1
Sequence:CCGGGTCTCACATGACAGCTATTAACTCGAGTTAATAGCTGTCATGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173538.1-210s1c1
Sequence:CCGGCCGGAGTATGAGCAATATCTTCTCGAGAAGATATTGCTCATACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173538.1-1268s1c1
Sequence:CCGGGCGTCCTTCTTCAAGTTCCTTCTCGAGAAGGAACTTGAAGAAGGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173538.1-676s1c1
Sequence:CCGGCCTCAAACAAACGTGTATAAACTCGAGTTTATACACGTTTGTTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173538.1-822s1c1
Sequence:CCGGGCTTAGCAAATGGAGTACCTTCTCGAGAAGGTACTCCATTTGCTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173538
CNBD1 MISSION shRNA Lentiviral Transduction Particles
cyclic nucleotide binding domain containing 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173538.2-1175s21c1
Sequence:CCGGTTGTGAAACTACGATCAAATACTCGAGTATTTGATCGTAGTTTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173538.2-81s21c1
Sequence:CCGGGTCTCACATGACAGCTATTAACTCGAGTTAATAGCTGTCATGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173538.1-210s1c1
Sequence:CCGGCCGGAGTATGAGCAATATCTTCTCGAGAAGATATTGCTCATACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173538.1-1268s1c1
Sequence:CCGGGCGTCCTTCTTCAAGTTCCTTCTCGAGAAGGAACTTGAAGAAGGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173538.1-676s1c1
Sequence:CCGGCCTCAAACAAACGTGTATAAACTCGAGTTTATACACGTTTGTTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173538.1-822s1c1
Sequence:CCGGGCTTAGCAAATGGAGTACCTTCTCGAGAAGGTACTCCATTTGCTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks