EMAIL THIS PAGE TO A FRIEND

CNBD2

cyclic nucleotide binding domain containing 2

99 Gene Product Result for
Synonyms: C20orf152 CNMPD1 dJ954P9.1
UniProtKB ID: Q96M20, Q14C79, Q5JWY7, Q5T3S1, Q9BR36, Q9BWY5
Gene ID:
Mouse(70873) cyclic nucleotide binding domain containing 2
Rat(296311) cyclic nucleotide binding domain containing 2
sheep(101120512) cyclic nucleotide binding domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043182 Anti-CNBD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080834 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080834 Rosetta Predictions human pricing
XM_215902 Rosetta Predictions rat pricing
XR_005427 Rosetta Predictions rat pricing
XR_009625 Rosetta Predictions rat pricing
NM_027585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019792 predicted 1478
2 SASI_Hs01_00019793 predicted 873
3 SASI_Hs01_00019796 predicted 1606
4 SASI_Hs01_00019798 predicted 348
5 SASI_Hs01_00019799 predicted 1574
6 SASI_Hs01_00019800 predicted 1159
7 SASI_Hs01_00019801 predicted 1279
8 SASI_Hs02_00362624 predicted 1705
9 SASI_Hs02_00362625 predicted 1188
10 SASI_Hs02_00362626 predicted 409
11 SASI_Hs01_00019794 predicted 1550
12 SASI_Hs01_00019795 predicted 284
13 SASI_Hs01_00019797 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00150858 predicted 1252
2 SASI_Rn01_00150859 predicted 710
3 SASI_Rn01_00150860 predicted 719
4 SASI_Rn01_00150861 predicted 1409
5 SASI_Rn01_00150862 predicted 1252
6 SASI_Rn01_00150863 predicted 657
7 SASI_Rn01_00150864 predicted 1318
8 SASI_Rn01_00150865 predicted 1211
9 SASI_Rn01_00150866 predicted 584
10 SASI_Rn01_00150867 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005427 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00409153 predicted 2307
2 SASI_Rn02_00409154 predicted 1108
3 SASI_Rn02_00409155 predicted 1171
4 SASI_Rn02_00409156 predicted 1467
5 SASI_Rn02_00409157 predicted 2708
6 SASI_Rn02_00409158 predicted 1169
7 SASI_Rn02_00409159 predicted 806
8 SASI_Rn02_00409160 predicted 3234
9 SASI_Rn02_00409161 predicted 2155
10 SASI_Rn02_00409162 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009625 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420423 predicted 1100
2 SASI_Rn02_00420424 predicted 1170
3 SASI_Rn02_00420425 predicted 1466
4 SASI_Rn02_00420426 predicted 3243
5 SASI_Rn02_00420427 predicted 2674
6 SASI_Rn02_00420428 predicted 1159
7 SASI_Rn02_00420429 predicted 798
8 SASI_Rn02_00420430 predicted 3199
9 SASI_Rn02_00420431 predicted 2153
10 SASI_Rn02_00420432 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332426 predicted 943
2 SASI_Mm02_00332427 predicted 1625
3 SASI_Mm02_00332428 predicted 895
4 SASI_Mm02_00332429 predicted 1416
5 SASI_Mm02_00332430 predicted 535
6 SASI_Mm02_00332431 predicted 1405
7 SASI_Mm02_00332432 predicted 1809
8 SASI_Mm02_00332433 predicted 210
9 SASI_Mm02_00332434 predicted 1877
10 SASI_Mm02_00332435 predicted 1492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080834
CNBD2 MISSION shRNA Bacterial Glycerol Stock
cyclic nucleotide binding domain containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080834.1-1119s1c1
Sequence:CCGGCCTGAGTGAATACTCTCCTATCTCGAGATAGGAGAGTATTCACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080834.1-541s1c1
Sequence:CCGGGCCAAAGTCATGCGCTTTGAACTCGAGTTCAAAGCGCATGACTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080834.1-360s1c1
Sequence:CCGGCCGAGTCACATTTGATACCATCTCGAGATGGTATCAAATGTGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080834.1-1737s1c1
Sequence:CCGGCCTGGATTTGTGCAGCATCAACTCGAGTTGATGCTGCACAAATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080834.1-1179s1c1
Sequence:CCGGGCAAGACTTTAGCTCCTTGAACTCGAGTTCAAGGAGCTAAAGTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080834.1-1325s21c1
Sequence:CCGGTCAAATGTGCCATGATCAATACTCGAGTATTGATCATGGCACATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080834.1-1481s21c1
Sequence:CCGGGAAATGAGTTGATACGGATAACTCGAGTTATCCGTATCAACTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080834
CNBD2 MISSION shRNA shRNA Plasmid DNA
cyclic nucleotide binding domain containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080834.1-1119s1c1
Sequence:CCGGCCTGAGTGAATACTCTCCTATCTCGAGATAGGAGAGTATTCACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080834.1-541s1c1
Sequence:CCGGGCCAAAGTCATGCGCTTTGAACTCGAGTTCAAAGCGCATGACTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080834.1-360s1c1
Sequence:CCGGCCGAGTCACATTTGATACCATCTCGAGATGGTATCAAATGTGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080834.1-1737s1c1
Sequence:CCGGCCTGGATTTGTGCAGCATCAACTCGAGTTGATGCTGCACAAATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080834.1-1179s1c1
Sequence:CCGGGCAAGACTTTAGCTCCTTGAACTCGAGTTCAAGGAGCTAAAGTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080834.1-1325s21c1
Sequence:CCGGTCAAATGTGCCATGATCAATACTCGAGTATTGATCATGGCACATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080834.1-1481s21c1
Sequence:CCGGGAAATGAGTTGATACGGATAACTCGAGTTATCCGTATCAACTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080834
CNBD2 MISSION shRNA Lentiviral Transduction Particles
cyclic nucleotide binding domain containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080834.1-1119s1c1
Sequence:CCGGCCTGAGTGAATACTCTCCTATCTCGAGATAGGAGAGTATTCACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080834.1-541s1c1
Sequence:CCGGGCCAAAGTCATGCGCTTTGAACTCGAGTTCAAAGCGCATGACTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080834.1-360s1c1
Sequence:CCGGCCGAGTCACATTTGATACCATCTCGAGATGGTATCAAATGTGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080834.1-1737s1c1
Sequence:CCGGCCTGGATTTGTGCAGCATCAACTCGAGTTGATGCTGCACAAATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080834.1-1179s1c1
Sequence:CCGGGCAAGACTTTAGCTCCTTGAACTCGAGTTCAAGGAGCTAAAGTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080834.1-1325s21c1
Sequence:CCGGTCAAATGTGCCATGATCAATACTCGAGTATTGATCATGGCACATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080834.1-1481s21c1
Sequence:CCGGGAAATGAGTTGATACGGATAACTCGAGTTATCCGTATCAACTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks