EMAIL THIS PAGE TO A FRIEND

CNBP

CCHC-type zinc finger, nucleic acid binding protein

183 Gene Product Result for
Synonyms: CNBP1 DM2 PROMM RNF163 ZCCHC22 ZNF9
Gene ID:
Human(7555) Summary: This gene encodes a nucleic-acid binding protein with seven zinc-finger domains. The protein has a preference for binding single stranded DNA and RNA. The protein functions in cap-independent translation of ornithine decarboxylase mRNA, and may also function in sterol-mediated transcriptional regulation. A CCTG expansion in the first intron of this gene results in myotonic dystrophy type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12785) cellular nucleic acid binding protein
Rat(64530) CCHC-type zinc finger, nucleic acid binding protein
chicken(395731) CCHC-type zinc finger, nucleic acid binding protein
domestic cat(101084689) CCHC-type zinc finger, nucleic acid binding protein
dog(476518) CCHC-type zinc finger, nucleic acid binding protein
cow(504831) CCHC-type zinc finger, nucleic acid binding protein
sheep(101106550) CCHC-type zinc finger, nucleic acid binding protein
domestic guinea pig(100718822) CCHC-type zinc finger, nucleic acid binding protein
naked mole-rat(101717456) CCHC-type zinc finger, nucleic acid binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013493 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013493 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013493 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003418 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127192 Rosetta Predictions human pricing
NM_001127193 Rosetta Predictions human pricing
NM_001127194 Rosetta Predictions human pricing
NM_001127195 Rosetta Predictions human pricing
NM_001127196 Rosetta Predictions human pricing
NM_003418 Rosetta Predictions human pricing
NM_022598 Rosetta Predictions rat pricing
NM_001109745 Rosetta Predictions mouse pricing
NM_001109746 Rosetta Predictions mouse pricing
NM_013493 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328647 predicted 1201
2 SASI_Hs02_00328648 predicted 665
3 SASI_Hs02_00328649 predicted 768
4 SASI_Hs02_00328650 predicted 670
5 SASI_Hs02_00328651 predicted 1184
6 SASI_Hs02_00328652 predicted 717
7 SASI_Hs02_00328653 predicted 1098
8 SASI_Hs02_00328654 predicted 775
9 SASI_Hs02_00328655 predicted 1160
10 SASI_Hs02_00328656 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328657 predicted 1202
2 SASI_Hs02_00328658 predicted 664
3 SASI_Hs02_00328659 predicted 762
4 SASI_Hs02_00328660 predicted 671
5 SASI_Hs02_00328661 predicted 1186
6 SASI_Hs02_00328662 predicted 719
7 SASI_Hs02_00328663 predicted 1090
8 SASI_Hs02_00328664 predicted 769
9 SASI_Hs02_00328665 predicted 1156
10 SASI_Hs02_00328666 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328667 predicted 1175
2 SASI_Hs02_00328668 predicted 648
3 SASI_Hs02_00328669 predicted 747
4 SASI_Hs02_00328670 predicted 649
5 SASI_Hs02_00328671 predicted 1168
6 SASI_Hs02_00328672 predicted 701
7 SASI_Hs02_00328673 predicted 1070
8 SASI_Hs02_00328674 predicted 752
9 SASI_Hs02_00328675 predicted 1136
10 SASI_Hs02_00328676 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328677 predicted 1178
2 SASI_Hs02_00328678 predicted 640
3 SASI_Hs02_00328679 predicted 750
4 SASI_Hs02_00328680 predicted 647
5 SASI_Hs02_00328681 predicted 1161
6 SASI_Hs02_00328682 predicted 696
7 SASI_Hs02_00328683 predicted 1066
8 SASI_Hs02_00328684 predicted 748
9 SASI_Hs02_00328685 predicted 1132
10 SASI_Hs02_00328686 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328687 predicted 1170
2 SASI_Hs02_00328688 predicted 634
3 SASI_Hs02_00328689 predicted 747
4 SASI_Hs02_00328690 predicted 647
5 SASI_Hs02_00328691 predicted 1165
6 SASI_Hs02_00328692 predicted 694
7 SASI_Hs02_00328693 predicted 1068
8 SASI_Hs02_00328694 predicted 744
9 SASI_Hs02_00328695 predicted 1134
10 SASI_Hs02_00328696 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335626 predicted 1195
2 SASI_Hs01_00143370 predicted 657
3 SASI_Hs01_00143372 predicted 767
4 SASI_Hs01_00143375 predicted 661
5 SASI_Hs02_00335627 predicted 1182
6 SASI_Hs01_00143377 predicted 718
7 SASI_Hs02_00335628 predicted 1086
8 SASI_Hs02_00335629 predicted 764
9 SASI_Hs02_00335630 predicted 1155
10 SASI_Hs02_00335631 predicted 1085
11 SASI_Hs01_00143371 predicted 742
12 SASI_Hs01_00143373 predicted 384
13 SASI_Hs01_00143374 predicted 512
14 SASI_Hs01_00143376 predicted 840
15 SASI_Hs01_00143378 predicted 789
16 SASI_Hs01_00143379 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022598 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073936 predicted 616
2 SASI_Rn01_00073937 predicted 615
3 SASI_Rn01_00073938 predicted 366
4 SASI_Rn01_00073939 predicted 1098
5 SASI_Rn01_00073940 predicted 532
6 SASI_Rn01_00073941 predicted 205
7 SASI_Rn02_00263347 predicted 1066
8 SASI_Rn01_00073942 predicted 443
9 SASI_Rn01_00073943 predicted 1099
10 SASI_Rn01_00073944 predicted 275
11 SASI_Rn01_00073945 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304204 predicted 651
2 SASI_Mm02_00304205 predicted 877
3 SASI_Mm02_00304206 predicted 760
4 SASI_Mm02_00304207 predicted 979
5 SASI_Mm02_00304208 predicted 1079
6 SASI_Mm02_00304209 predicted 929
7 SASI_Mm02_00304210 predicted 843
8 SASI_Mm02_00304211 predicted 705
9 SASI_Mm02_00304212 predicted 906
10 SASI_Mm02_00304213 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304214 predicted 653
2 SASI_Mm02_00304215 predicted 880
3 SASI_Mm02_00304216 predicted 753
4 SASI_Mm02_00304217 predicted 969
5 SASI_Mm02_00304218 predicted 1077
6 SASI_Mm02_00304219 predicted 926
7 SASI_Mm02_00304220 predicted 832
8 SASI_Mm02_00304221 predicted 709
9 SASI_Mm02_00304222 predicted 905
10 SASI_Mm02_00304223 predicted 1111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102377 predicted 673
2 SASI_Mm02_00322132 predicted 905
3 SASI_Mm01_00102379 predicted 780
4 SASI_Mm01_00102380 predicted 993
5 SASI_Mm02_00322133 predicted 1092
6 SASI_Mm01_00102382 predicted 949
7 SASI_Mm02_00322134 predicted 860
8 SASI_Mm02_00322135 predicted 730
9 SASI_Mm01_00102383 predicted 932
10 SASI_Mm02_00322136 predicted 1132
11 SASI_Mm01_00102378 predicted 464
12 SASI_Mm01_00102381 predicted 571
13 SASI_Mm01_00102384 predicted 842
14 SASI_Mm01_00102385 predicted 983
15 SASI_Mm01_00102386 predicted 894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013493
VALIDATED
CNBP MISSION shRNA Bacterial Glycerol Stock
CCHC-type zinc finger, nucleic acid binding protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013493.3-737s21c1
Sequence:CCGGATTGAGGCTACAGCCTAATTACTCGAGTAATTAGGCTGTAGCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013493.3-346s21c1
Sequence:CCGGCCAGTTTGTTTCCTCGTCTCTCTCGAGAGAGACGAGGAAACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013493.3-428s21c1
Sequence:CCGGGAGGATGAAGCCTGCTATAACCTCGAGGTTATAGCAGGCTTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013493.3-574s21c1
Sequence:CCGGGTGCTATTCTTGTGGTGAATTCTCGAGAATTCACCACAAGAATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013493.3-998s21c1
Sequence:CCGGCCACTGGTGAATAGGGATTAACTCGAGTTAATCCCTATTCACCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013493.2-537s1c1
Sequence:CCGGCTGGTCATGTAGCCATCAATTCTCGAGAATTGATGGCTACATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013493.2-235s1c1
Sequence:CCGGCCAGTTTGTTTCCTCGTCTCTCTCGAGAGAGACGAGGAAACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013493.2-388s1c1
Sequence:CCGGGCGAGAGCAATGCTGCTACAACTCGAGTTGTAGCAGCATTGCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013493.2-887s1c1
Sequence:CCGGCCACTGGTGAATAGGGATTAACTCGAGTTAATCCCTATTCACCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013493
VALIDATED
CNBP MISSION shRNA shRNA Plasmid DNA
CCHC-type zinc finger, nucleic acid binding protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013493.3-737s21c1
Sequence:CCGGATTGAGGCTACAGCCTAATTACTCGAGTAATTAGGCTGTAGCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013493.3-346s21c1
Sequence:CCGGCCAGTTTGTTTCCTCGTCTCTCTCGAGAGAGACGAGGAAACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013493.3-428s21c1
Sequence:CCGGGAGGATGAAGCCTGCTATAACCTCGAGGTTATAGCAGGCTTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013493.3-574s21c1
Sequence:CCGGGTGCTATTCTTGTGGTGAATTCTCGAGAATTCACCACAAGAATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013493.3-998s21c1
Sequence:CCGGCCACTGGTGAATAGGGATTAACTCGAGTTAATCCCTATTCACCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013493.2-537s1c1
Sequence:CCGGCTGGTCATGTAGCCATCAATTCTCGAGAATTGATGGCTACATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013493.2-235s1c1
Sequence:CCGGCCAGTTTGTTTCCTCGTCTCTCTCGAGAGAGACGAGGAAACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013493.2-388s1c1
Sequence:CCGGGCGAGAGCAATGCTGCTACAACTCGAGTTGTAGCAGCATTGCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013493.2-887s1c1
Sequence:CCGGCCACTGGTGAATAGGGATTAACTCGAGTTAATCCCTATTCACCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013493
VALIDATED
CNBP MISSION shRNA Lentiviral Transduction Particles
CCHC-type zinc finger, nucleic acid binding protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013493.3-737s21c1
Sequence:CCGGATTGAGGCTACAGCCTAATTACTCGAGTAATTAGGCTGTAGCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013493.3-346s21c1
Sequence:CCGGCCAGTTTGTTTCCTCGTCTCTCTCGAGAGAGACGAGGAAACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013493.3-428s21c1
Sequence:CCGGGAGGATGAAGCCTGCTATAACCTCGAGGTTATAGCAGGCTTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013493.3-574s21c1
Sequence:CCGGGTGCTATTCTTGTGGTGAATTCTCGAGAATTCACCACAAGAATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013493.3-998s21c1
Sequence:CCGGCCACTGGTGAATAGGGATTAACTCGAGTTAATCCCTATTCACCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013493.2-537s1c1
Sequence:CCGGCTGGTCATGTAGCCATCAATTCTCGAGAATTGATGGCTACATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013493.2-235s1c1
Sequence:CCGGCCAGTTTGTTTCCTCGTCTCTCTCGAGAGAGACGAGGAAACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013493.2-388s1c1
Sequence:CCGGGCGAGAGCAATGCTGCTACAACTCGAGTTGTAGCAGCATTGCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013493.2-887s1c1
Sequence:CCGGCCACTGGTGAATAGGGATTAACTCGAGTTAATCCCTATTCACCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003418
VALIDATED
CNBP MISSION shRNA Bacterial Glycerol Stock
CCHC-type zinc finger, nucleic acid binding protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_003418.4-322s21c1
Sequence:CCGGCGGATAGAGGTTTCCAGTTTGCTCGAGCAAACTGGAAACCTCTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003418.4-1150s21c1
Sequence:GTACCGGTCTGACCTCAGTAGCTATTAACTCGAGTTAATAGCTACTGAGGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003418.4-723s21c1
Sequence:GTACCGGATTGAGGCTACAGCCTAATTACTCGAGTAATTAGGCTGTAGCCTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003418.4-601s21c1
Sequence:CCGGGCACCAAAGTGAAGTGCTATACTCGAGTATAGCACTTCACTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003418.1-1094s1c1
Sequence:CCGGCCCTACATAGAACATACAGTTCTCGAGAACTGTATGTTCTATGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003418.1-497s1c1
Sequence:CCGGGCACCAAAGTGAAGTGCTATACTCGAGTATAGCACTTCACTTTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003418.1-442s1c1
Sequence:CCGGGCAGATGAGCAGAAATGCTATCTCGAGATAGCATTTCTGCTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003418.1-242s1c1
Sequence:CCGGCCTCGTCTCTTCCAGATATTTCTCGAGAAATATCTGGAAGAGACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003418.1-552s1c1
Sequence:CCGGCAGCAAGACAAGTGAAGTCAACTCGAGTTGACTTCACTTGTCTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003418
VALIDATED
CNBP MISSION shRNA shRNA Plasmid DNA
CCHC-type zinc finger, nucleic acid binding protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_003418.4-322s21c1
Sequence:CCGGCGGATAGAGGTTTCCAGTTTGCTCGAGCAAACTGGAAACCTCTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003418.4-1150s21c1
Sequence:GTACCGGTCTGACCTCAGTAGCTATTAACTCGAGTTAATAGCTACTGAGGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003418.4-723s21c1
Sequence:GTACCGGATTGAGGCTACAGCCTAATTACTCGAGTAATTAGGCTGTAGCCTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003418.4-601s21c1
Sequence:CCGGGCACCAAAGTGAAGTGCTATACTCGAGTATAGCACTTCACTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003418.1-1094s1c1
Sequence:CCGGCCCTACATAGAACATACAGTTCTCGAGAACTGTATGTTCTATGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003418.1-497s1c1
Sequence:CCGGGCACCAAAGTGAAGTGCTATACTCGAGTATAGCACTTCACTTTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003418.1-442s1c1
Sequence:CCGGGCAGATGAGCAGAAATGCTATCTCGAGATAGCATTTCTGCTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003418.1-242s1c1
Sequence:CCGGCCTCGTCTCTTCCAGATATTTCTCGAGAAATATCTGGAAGAGACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003418.1-552s1c1
Sequence:CCGGCAGCAAGACAAGTGAAGTCAACTCGAGTTGACTTCACTTGTCTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003418
VALIDATED
CNBP MISSION shRNA Lentiviral Transduction Particles
CCHC-type zinc finger, nucleic acid binding protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_003418.4-322s21c1
Sequence:CCGGCGGATAGAGGTTTCCAGTTTGCTCGAGCAAACTGGAAACCTCTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003418.4-1150s21c1
Sequence:GTACCGGTCTGACCTCAGTAGCTATTAACTCGAGTTAATAGCTACTGAGGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003418.4-723s21c1
Sequence:GTACCGGATTGAGGCTACAGCCTAATTACTCGAGTAATTAGGCTGTAGCCTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003418.4-601s21c1
Sequence:CCGGGCACCAAAGTGAAGTGCTATACTCGAGTATAGCACTTCACTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003418.1-1094s1c1
Sequence:CCGGCCCTACATAGAACATACAGTTCTCGAGAACTGTATGTTCTATGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003418.1-497s1c1
Sequence:CCGGGCACCAAAGTGAAGTGCTATACTCGAGTATAGCACTTCACTTTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003418.1-442s1c1
Sequence:CCGGGCAGATGAGCAGAAATGCTATCTCGAGATAGCATTTCTGCTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003418.1-242s1c1
Sequence:CCGGCCTCGTCTCTTCCAGATATTTCTCGAGAAATATCTGGAAGAGACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003418.1-552s1c1
Sequence:CCGGCAGCAAGACAAGTGAAGTCAACTCGAGTTGACTTCACTTGTCTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks