EMAIL THIS PAGE TO A FRIEND

CNDP1

carnosine dipeptidase 1 (metallopeptidase M20 family)

52 Gene Product Result for
Synonyms: CN1 CPGL2 HsT2308
UniProtKB ID: Q96KN2, Q14D40, Q17S05, Q2TBG0, Q6UWK2, Q9BT98
Gene ID:
Human(84735) Summary: This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region. [provided by RefSeq, Jul 2008]
Mouse(338403) carnosine dipeptidase 1 (metallopeptidase M20 family)
Rat(307212) carnosine dipeptidase 1 (metallopeptidase M20 family)
chicken(421012) carnosine dipeptidase 1 (metallopeptidase M20 family)
dog(476165) carnosine dipeptidase 1 (metallopeptidase M20 family)
Horse(100061728) carnosine dipeptidase 1 (metallopeptidase M20 family)
cow(614200) carnosine dipeptidase 1 (metallopeptidase M20 family)
domestic cat(101099503) carnosine dipeptidase 1 (metallopeptidase M20 family)
sheep(101110987) carnosine dipeptidase 1 (metallopeptidase M20 family)
naked mole-rat(101707301) carnosine dipeptidase 1 (metallopeptidase M20 family)
domestic guinea pig(100729620) carnosine dipeptidase 1 (metallopeptidase M20 family)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177450 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177450 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177450 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032649 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066961 MISSION® esiRNA esiRNA human CNDP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032649 Rosetta Predictions human pricing
NM_001007687 Rosetta Predictions rat pricing
NM_177450 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133134 predicted 1688
2 SASI_Hs01_00133135 predicted 1589
3 SASI_Hs01_00133136 predicted 1414
4 SASI_Hs01_00133137 predicted 766
5 SASI_Hs01_00133138 predicted 1545
6 SASI_Hs01_00133139 predicted 1296
7 SASI_Hs01_00133140 predicted 1182
8 SASI_Hs01_00133141 predicted 1350
9 SASI_Hs01_00133142 predicted 1805
10 SASI_Hs01_00133143 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007687 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079702 predicted 1512
2 SASI_Rn01_00079703 predicted 917
3 SASI_Rn01_00079704 predicted 551
4 SASI_Rn02_00198833 predicted 788
5 SASI_Rn01_00079706 predicted 373
6 SASI_Rn01_00079707 predicted 223
7 SASI_Rn01_00079708 predicted 1682
8 SASI_Rn01_00079709 predicted 1548
9 SASI_Rn01_00079710 predicted 1109
10 SASI_Rn01_00079711 predicted 288
11 SASI_Rn01_00079705 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192848 predicted 481
2 SASI_Mm01_00192849 predicted 1509
3 SASI_Mm01_00192850 predicted 524
4 SASI_Mm01_00192851 predicted 1664
5 SASI_Mm01_00192852 predicted 1464
6 SASI_Mm01_00192853 predicted 1086
7 SASI_Mm01_00192855 predicted 1541
8 SASI_Mm01_00192856 predicted 1093
9 SASI_Mm01_00192857 predicted 1007
10 SASI_Mm02_00347652 predicted 1172
11 SASI_Mm01_00192854 predicted 1121
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177450
CNDP1 MISSION shRNA Bacterial Glycerol Stock
carnosine dipeptidase 1 (metallopeptidase M20 family)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177450.2-1134s1c1
Sequence:CCGGCCTAGAAGAATACCAGAACATCTCGAGATGTTCTGGTATTCTTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177450.2-1662s1c1
Sequence:CCGGGTCGAAATTATTCGCTGCCTTCTCGAGAAGGCAGCGAATAATTTCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177450.2-1050s1c1
Sequence:CCGGCCACATCCTAATTCCTGGAATCTCGAGATTCCAGGAATTAGGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177450.2-552s1c1
Sequence:CCGGCGAGAAGCCAACTGTATGCTTCTCGAGAAGCATACAGTTGGCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177450.2-1006s1c1
Sequence:CCGGGCTGACTTGGTTGCTCTTCTACTCGAGTAGAAGAGCAACCAAGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177450.4-1963s21c1
Sequence:CCGGGGGTGTCTCTTTAGTCAATTACTCGAGTAATTGACTAAAGAGACACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177450
CNDP1 MISSION shRNA shRNA Plasmid DNA
carnosine dipeptidase 1 (metallopeptidase M20 family)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177450.2-1134s1c1
Sequence:CCGGCCTAGAAGAATACCAGAACATCTCGAGATGTTCTGGTATTCTTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177450.2-1662s1c1
Sequence:CCGGGTCGAAATTATTCGCTGCCTTCTCGAGAAGGCAGCGAATAATTTCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177450.2-1050s1c1
Sequence:CCGGCCACATCCTAATTCCTGGAATCTCGAGATTCCAGGAATTAGGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177450.2-552s1c1
Sequence:CCGGCGAGAAGCCAACTGTATGCTTCTCGAGAAGCATACAGTTGGCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177450.2-1006s1c1
Sequence:CCGGGCTGACTTGGTTGCTCTTCTACTCGAGTAGAAGAGCAACCAAGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177450.4-1963s21c1
Sequence:CCGGGGGTGTCTCTTTAGTCAATTACTCGAGTAATTGACTAAAGAGACACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177450
CNDP1 MISSION shRNA Lentiviral Transduction Particles
carnosine dipeptidase 1 (metallopeptidase M20 family)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177450.2-1134s1c1
Sequence:CCGGCCTAGAAGAATACCAGAACATCTCGAGATGTTCTGGTATTCTTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177450.2-1662s1c1
Sequence:CCGGGTCGAAATTATTCGCTGCCTTCTCGAGAAGGCAGCGAATAATTTCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177450.2-1050s1c1
Sequence:CCGGCCACATCCTAATTCCTGGAATCTCGAGATTCCAGGAATTAGGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177450.2-552s1c1
Sequence:CCGGCGAGAAGCCAACTGTATGCTTCTCGAGAAGCATACAGTTGGCTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177450.2-1006s1c1
Sequence:CCGGGCTGACTTGGTTGCTCTTCTACTCGAGTAGAAGAGCAACCAAGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177450.4-1963s21c1
Sequence:CCGGGGGTGTCTCTTTAGTCAATTACTCGAGTAATTGACTAAAGAGACACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032649
CNDP1 MISSION shRNA Bacterial Glycerol Stock
carnosine dipeptidase 1 (metallopeptidase M20 family)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032649.4-1648s1c1
Sequence:CCGGCCAGAGAATTTGGGTCTAGTACTCGAGTACTAGACCCAAATTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032649.4-975s1c1
Sequence:CCGGGCCATCCATCTAGACCTAGAACTCGAGTTCTAGGTCTAGATGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032649.4-1339s1c1
Sequence:CCGGCGATCAGAACAGTGTTTGGAACTCGAGTTCCAAACACTGTTCTGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032649.4-1464s1c1
Sequence:CCGGGATGGAGAACATTCGCAGAATCTCGAGATTCTGCGAATGTTCTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032649.4-350s1c1
Sequence:CCGGCGATGGTCAGAGTCTTCCAATCTCGAGATTGGAAGACTCTGACCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032649.5-1300s21c1
Sequence:CCGGAGTCATACCTGGCCGAGTTATCTCGAGATAACTCGGCCAGGTATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032649.5-1870s21c1
Sequence:CCGGTGGGATATCTGGATCAGTAATCTCGAGATTACTGATCCAGATATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032649.5-338s21c1
Sequence:CCGGGACCTCCATCAGGATGAATTTCTCGAGAAATTCATCCTGATGGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032649
CNDP1 MISSION shRNA shRNA Plasmid DNA
carnosine dipeptidase 1 (metallopeptidase M20 family)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032649.4-1648s1c1
Sequence:CCGGCCAGAGAATTTGGGTCTAGTACTCGAGTACTAGACCCAAATTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032649.4-975s1c1
Sequence:CCGGGCCATCCATCTAGACCTAGAACTCGAGTTCTAGGTCTAGATGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032649.4-1339s1c1
Sequence:CCGGCGATCAGAACAGTGTTTGGAACTCGAGTTCCAAACACTGTTCTGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032649.4-1464s1c1
Sequence:CCGGGATGGAGAACATTCGCAGAATCTCGAGATTCTGCGAATGTTCTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032649.4-350s1c1
Sequence:CCGGCGATGGTCAGAGTCTTCCAATCTCGAGATTGGAAGACTCTGACCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032649.5-1300s21c1
Sequence:CCGGAGTCATACCTGGCCGAGTTATCTCGAGATAACTCGGCCAGGTATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032649.5-1870s21c1
Sequence:CCGGTGGGATATCTGGATCAGTAATCTCGAGATTACTGATCCAGATATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032649.5-338s21c1
Sequence:CCGGGACCTCCATCAGGATGAATTTCTCGAGAAATTCATCCTGATGGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032649
CNDP1 MISSION shRNA Lentiviral Transduction Particles
carnosine dipeptidase 1 (metallopeptidase M20 family)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032649.4-1648s1c1
Sequence:CCGGCCAGAGAATTTGGGTCTAGTACTCGAGTACTAGACCCAAATTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032649.4-975s1c1
Sequence:CCGGGCCATCCATCTAGACCTAGAACTCGAGTTCTAGGTCTAGATGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032649.4-1339s1c1
Sequence:CCGGCGATCAGAACAGTGTTTGGAACTCGAGTTCCAAACACTGTTCTGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032649.4-1464s1c1
Sequence:CCGGGATGGAGAACATTCGCAGAATCTCGAGATTCTGCGAATGTTCTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032649.4-350s1c1
Sequence:CCGGCGATGGTCAGAGTCTTCCAATCTCGAGATTGGAAGACTCTGACCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032649.5-1300s21c1
Sequence:CCGGAGTCATACCTGGCCGAGTTATCTCGAGATAACTCGGCCAGGTATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032649.5-1870s21c1
Sequence:CCGGTGGGATATCTGGATCAGTAATCTCGAGATTACTGATCCAGATATCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032649.5-338s21c1
Sequence:CCGGGACCTCCATCAGGATGAATTTCTCGAGAAATTCATCCTGATGGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)