EMAIL THIS PAGE TO A FRIEND

CNDP2

CNDP dipeptidase 2 (metallopeptidase M20 family)

70 Gene Product Result for
Synonyms: CN2 CPGL HsT2298 PEPA
UniProtKB ID: Q96KP4, B3KUG4, Q8WY59, Q9BQ94, Q9NVB4
Gene ID:
Human(55748) Summary: CNDP2, also known as tissue carnosinase and peptidase A (EC 3.4.13.18), is a nonspecific dipeptidase rather than a selective carnosinase (Teufel et al., 2003 [PubMed 12473676]
Mouse(66054) CNDP dipeptidase 2 (metallopeptidase M20 family)
Rat(291394) CNDP dipeptidase 2 (metallopeptidase M20 family)
domestic guinea pig(100735444) CNDP dipeptidase 2 (metallopeptidase M20 family)
naked mole-rat(101709694) CNDP dipeptidase 2 (metallopeptidase M20 family)
sheep(101111244) CNDP dipeptidase 2 (metallopeptidase M20 family)
Domestic Rabbit(100347984) CNDP dipeptidase 2 (metallopeptidase M20 family)
Zebrafish(327288) CNDP dipeptidase 2 (metallopeptidase M20 family)
cow(281388) CNDP dipeptidase 2 (metallopeptidase M20 family)
cow(512626) CNDP dipeptidase 2 (metallopeptidase M20 family)
Horse(100061697) CNDP dipeptidase 2 (metallopeptidase M20 family)
domestic cat(101095774) CNDP dipeptidase 2 (metallopeptidase M20 family)
dog(476166) CNDP dipeptidase 2 (metallopeptidase M20 family)
chicken(421013) CNDP dipeptidase 2 (metallopeptidase M20 family)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018235 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023149 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023149 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023149 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018235 Rosetta Predictions human pricing
NM_001010920 Rosetta Predictions rat pricing
XM_579330 Rosetta Predictions rat pricing
NM_023149 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187296 predicted 377
2 SASI_Hs01_00187297 predicted 699
3 SASI_Hs01_00187298 predicted 738
4 SASI_Hs01_00187299 predicted 999
5 SASI_Hs01_00187301 predicted 330
6 SASI_Hs01_00187302 predicted 1061
7 SASI_Hs01_00187303 predicted 1068
8 SASI_Hs02_00351573 predicted 660
9 SASI_Hs02_00351574 predicted 1097
10 SASI_Hs02_00351575 predicted 446
11 SASI_Hs01_00187300 predicted 272
12 SASI_Hs01_00187304 predicted 1164
13 SASI_Hs01_00187305 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092745 predicted 1553
2 SASI_Rn01_00092747 predicted 315
3 SASI_Rn01_00092748 predicted 1149
4 SASI_Rn01_00092749 predicted 1475
5 SASI_Rn01_00092750 predicted 1162
6 SASI_Rn01_00092751 predicted 1482
7 SASI_Rn01_00092752 predicted 1091
8 SASI_Rn02_00199818 predicted 645
9 SASI_Rn01_00092754 predicted 990
10 SASI_Rn02_00199819 predicted 1448
11 SASI_Rn01_00092746 predicted 933
12 SASI_Rn01_00092753 predicted 1519
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142698 predicted 1123
2 SASI_Rn01_00142699 predicted 1139
3 SASI_Rn01_00142700 predicted 314
4 SASI_Rn01_00142701 predicted 1156
5 SASI_Rn01_00142702 predicted 1150
6 SASI_Rn01_00142703 predicted 558
7 SASI_Rn01_00142704 predicted 1155
8 SASI_Rn01_00142705 predicted 460
9 SASI_Rn01_00142706 predicted 328
10 SASI_Rn01_00142707 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115925 predicted 1520
2 SASI_Mm01_00115926 predicted 1416
3 SASI_Mm01_00115927 predicted 892
4 SASI_Mm01_00115928 predicted 282
5 SASI_Mm01_00115929 predicted 1301
6 SASI_Mm01_00115930 predicted 1112
7 SASI_Mm01_00115931 predicted 592
8 SASI_Mm01_00115932 predicted 340
9 SASI_Mm01_00115933 predicted 1469
10 SASI_Mm01_00115934 predicted 624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018235
VALIDATED
CNDP2 MISSION shRNA Bacterial Glycerol Stock
CNDP dipeptidase 2 (metallopeptidase M20 family)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_018235.1-1242s21c1
Sequence:CCGGCCTAACTAAGAAGTTTGCTGACTCGAGTCAGCAAACTTCTTAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018235.1-699s21c1
Sequence:CCGGCCGGAAAGACACATTCTTTAACTCGAGTTAAAGAATGTGTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018235.1-827s21c1
Sequence:CCGGGCAGCAACAAAGACCTCCATTCTCGAGAATGGAGGTCTTTGTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018235.1-1002s21c1
Sequence:CCGGCGACTTTGACATAGAGGAGTTCTCGAGAACTCCTCTATGTCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018235.1-1242s1c1
Sequence:CCGGCCTAACTAAGAAGTTTGCTGACTCGAGTCAGCAAACTTCTTAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018235.1-827s1c1
Sequence:CCGGGCAGCAACAAAGACCTCCATTCTCGAGAATGGAGGTCTTTGTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018235.1-212s1c1
Sequence:CCGGGCTACATTAAGAAACTCGCAACTCGAGTTGCGAGTTTCTTAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018235.1-699s1c1
Sequence:CCGGCCGGAAAGACACATTCTTTAACTCGAGTTAAAGAATGTGTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018235.1-1002s1c1
Sequence:CCGGCGACTTTGACATAGAGGAGTTCTCGAGAACTCCTCTATGTCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018235
VALIDATED
CNDP2 MISSION shRNA shRNA Plasmid DNA
CNDP dipeptidase 2 (metallopeptidase M20 family)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_018235.1-1242s21c1
Sequence:CCGGCCTAACTAAGAAGTTTGCTGACTCGAGTCAGCAAACTTCTTAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018235.1-699s21c1
Sequence:CCGGCCGGAAAGACACATTCTTTAACTCGAGTTAAAGAATGTGTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018235.1-827s21c1
Sequence:CCGGGCAGCAACAAAGACCTCCATTCTCGAGAATGGAGGTCTTTGTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018235.1-1002s21c1
Sequence:CCGGCGACTTTGACATAGAGGAGTTCTCGAGAACTCCTCTATGTCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018235.1-1242s1c1
Sequence:CCGGCCTAACTAAGAAGTTTGCTGACTCGAGTCAGCAAACTTCTTAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018235.1-827s1c1
Sequence:CCGGGCAGCAACAAAGACCTCCATTCTCGAGAATGGAGGTCTTTGTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018235.1-212s1c1
Sequence:CCGGGCTACATTAAGAAACTCGCAACTCGAGTTGCGAGTTTCTTAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018235.1-699s1c1
Sequence:CCGGCCGGAAAGACACATTCTTTAACTCGAGTTAAAGAATGTGTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018235.1-1002s1c1
Sequence:CCGGCGACTTTGACATAGAGGAGTTCTCGAGAACTCCTCTATGTCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018235
VALIDATED
CNDP2 MISSION shRNA Lentiviral Transduction Particles
CNDP dipeptidase 2 (metallopeptidase M20 family)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_018235.1-1242s21c1
Sequence:CCGGCCTAACTAAGAAGTTTGCTGACTCGAGTCAGCAAACTTCTTAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018235.1-699s21c1
Sequence:CCGGCCGGAAAGACACATTCTTTAACTCGAGTTAAAGAATGTGTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018235.1-827s21c1
Sequence:CCGGGCAGCAACAAAGACCTCCATTCTCGAGAATGGAGGTCTTTGTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018235.1-1002s21c1
Sequence:CCGGCGACTTTGACATAGAGGAGTTCTCGAGAACTCCTCTATGTCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018235.1-1242s1c1
Sequence:CCGGCCTAACTAAGAAGTTTGCTGACTCGAGTCAGCAAACTTCTTAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018235.1-827s1c1
Sequence:CCGGGCAGCAACAAAGACCTCCATTCTCGAGAATGGAGGTCTTTGTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018235.1-212s1c1
Sequence:CCGGGCTACATTAAGAAACTCGCAACTCGAGTTGCGAGTTTCTTAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018235.1-699s1c1
Sequence:CCGGCCGGAAAGACACATTCTTTAACTCGAGTTAAAGAATGTGTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018235.1-1002s1c1
Sequence:CCGGCGACTTTGACATAGAGGAGTTCTCGAGAACTCCTCTATGTCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023149
VALIDATED
CNDP2 MISSION shRNA Bacterial Glycerol Stock
CNDP dipeptidase 2 (metallopeptidase M20 family)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000032074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023149.2-1839s1c1
Sequence:CCGGCCAGGAAGGAAATGAGAGCATCTCGAGATGCTCTCATTTCCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023149.2-1097s1c1
Sequence:CCGGCCAGACATGATACCGGAAGTTCTCGAGAACTTCCGGTATCATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023149.2-892s1c1
Sequence:CCGGCGACCACATTGACTTCGATATCTCGAGATATCGAAGTCAATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023149.2-107s1c1
Sequence:CCGGGACCGCTACGTCAAGAAACTTCTCGAGAAGTTTCTTGACGTAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023149
VALIDATED
CNDP2 MISSION shRNA shRNA Plasmid DNA
CNDP dipeptidase 2 (metallopeptidase M20 family)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000032074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023149.2-1839s1c1
Sequence:CCGGCCAGGAAGGAAATGAGAGCATCTCGAGATGCTCTCATTTCCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023149.2-1097s1c1
Sequence:CCGGCCAGACATGATACCGGAAGTTCTCGAGAACTTCCGGTATCATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023149.2-892s1c1
Sequence:CCGGCGACCACATTGACTTCGATATCTCGAGATATCGAAGTCAATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023149.2-107s1c1
Sequence:CCGGGACCGCTACGTCAAGAAACTTCTCGAGAAGTTTCTTGACGTAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023149
VALIDATED
CNDP2 MISSION shRNA Lentiviral Transduction Particles
CNDP dipeptidase 2 (metallopeptidase M20 family)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000032074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023149.2-1839s1c1
Sequence:CCGGCCAGGAAGGAAATGAGAGCATCTCGAGATGCTCTCATTTCCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023149.2-1097s1c1
Sequence:CCGGCCAGACATGATACCGGAAGTTCTCGAGAACTTCCGGTATCATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023149.2-892s1c1
Sequence:CCGGCGACCACATTGACTTCGATATCTCGAGATATCGAAGTCAATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023149.2-107s1c1
Sequence:CCGGGACCGCTACGTCAAGAAACTTCTCGAGAAGTTTCTTGACGTAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks