EMAIL THIS PAGE TO A FRIEND

CNEP1R1

CTD nuclear envelope phosphatase 1 regulatory subunit 1

166 Gene Product Result for
Synonyms: C16orf69 NEP1-R1 TMEM188 TMP125
UniProtKB ID: Q8N9A8, Q4G1A9, Q5H9V0, Q8NE06
Gene ID:
Mouse(382030) CTD nuclear envelope phosphatase 1 regulatory subunit 1
Rat(291914) CTD nuclear envelope phosphatase 1 regulatory subunit 1
Zebrafish(550572) CTD nuclear envelope phosphatase 1 regulatory subunit 1
chicken(415736) CTD nuclear envelope phosphatase 1 regulatory subunit 1
cow(507593) transmembrane protein 188
domestic cat(101091242) CTD nuclear envelope phosphatase 1 regulatory subunit 1
sheep(101112154) CTD nuclear envelope phosphatase 1 regulatory subunit 1
naked mole-rat(101714155) CTD nuclear envelope phosphatase 1 regulatory subunit 1
domestic guinea pig(100727717) CTD nuclear envelope phosphatase 1 regulatory subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153261 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029074 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029074 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029074 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153261 Rosetta Predictions human pricing
NM_001106173 Rosetta Predictions rat pricing
NM_029074 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045898 predicted 567
2 SASI_Hs01_00045899 predicted 653
3 SASI_Hs02_00367129 predicted 626
4 SASI_Hs01_00045900 predicted 670
5 SASI_Hs01_00045901 predicted 574
6 SASI_Hs01_00045902 predicted 452
7 SASI_Hs01_00045903 predicted 194
8 SASI_Hs02_00367130 predicted 346
9 SASI_Hs01_00045905 predicted 668
10 SASI_Hs01_00045906 predicted 605
11 SASI_Hs01_00045904 predicted 460
12 SASI_Hs01_00045907 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106173 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216348 predicted 584
2 SASI_Rn02_00216349 predicted 657
3 SASI_Rn02_00216350 predicted 569
4 SASI_Rn02_00216351 predicted 480
5 SASI_Rn02_00216352 predicted 723
6 SASI_Rn02_00216353 predicted 662
7 SASI_Rn02_00216354 predicted 413
8 SASI_Rn02_00216355 predicted 354
9 SASI_Rn02_00216356 predicted 522
10 SASI_Rn02_00216357 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334829 predicted 380
2 SASI_Mm02_00334830 predicted 709
3 SASI_Mm02_00334831 predicted 409
4 SASI_Mm02_00334832 predicted 791
5 SASI_Mm02_00334833 predicted 642
6 SASI_Mm02_00334834 predicted 554
7 SASI_Mm02_00334835 predicted 654
8 SASI_Mm02_00334836 predicted 692
9 SASI_Mm02_00334837 predicted 291
10 SASI_Mm02_00334838 predicted 395
11 SASI_Mm01_00030231 predicted 434
12 SASI_Mm01_00030232 predicted 433
13 SASI_Mm01_00030233 predicted 830
14 SASI_Mm01_00030234 predicted 400
15 SASI_Mm01_00030235 predicted 625
16 SASI_Mm01_00030236 predicted 730
17 SASI_Mm01_00030237 predicted 328
18 SASI_Mm01_00030238 predicted 269
19 SASI_Mm01_00030239 predicted 740
20 SASI_Mm01_00030240 predicted 852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153261
VALIDATED
CNEP1R1 MISSION shRNA Bacterial Glycerol Stock
CTD nuclear envelope phosphatase 1 regulatory subunit 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153261.3-132s1c1
Sequence:CCGGGAGGAGACTTACTGAATATATCTCGAGATATATTCAGTAAGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153261.3-185s1c1
Sequence:CCGGGAATGCTTCTTATAGTGGTATCTCGAGATACCACTATAAGAAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153261.3-716s1c1
Sequence:CCGGGCAGATGAAGTATGTATGTATCTCGAGATACATACATACTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153261.4-304s21c1
Sequence:CCGGTTAGCTGTATCACTCTAATAGCTCGAGCTATTAGAGTGATACAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_153261.4-1706s21c1
Sequence:CCGGTAATAGCCGCATGTACTATAACTCGAGTTATAGTACATGCGGCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153261.4-378s21c1
Sequence:CCGGGCTCGATGTCGAACGGTATTACTCGAGTAATACCGTTCGACATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153261.4-221s21c1
Sequence:CCGGTGGTGCCTGGAACTGGTTAATCTCGAGATTAACCAGTTCCAGGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153261
VALIDATED
CNEP1R1 MISSION shRNA shRNA Plasmid DNA
CTD nuclear envelope phosphatase 1 regulatory subunit 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153261.3-132s1c1
Sequence:CCGGGAGGAGACTTACTGAATATATCTCGAGATATATTCAGTAAGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153261.3-185s1c1
Sequence:CCGGGAATGCTTCTTATAGTGGTATCTCGAGATACCACTATAAGAAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153261.3-716s1c1
Sequence:CCGGGCAGATGAAGTATGTATGTATCTCGAGATACATACATACTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153261.4-304s21c1
Sequence:CCGGTTAGCTGTATCACTCTAATAGCTCGAGCTATTAGAGTGATACAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_153261.4-1706s21c1
Sequence:CCGGTAATAGCCGCATGTACTATAACTCGAGTTATAGTACATGCGGCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153261.4-378s21c1
Sequence:CCGGGCTCGATGTCGAACGGTATTACTCGAGTAATACCGTTCGACATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153261.4-221s21c1
Sequence:CCGGTGGTGCCTGGAACTGGTTAATCTCGAGATTAACCAGTTCCAGGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153261
VALIDATED
CNEP1R1 MISSION shRNA Lentiviral Transduction Particles
CTD nuclear envelope phosphatase 1 regulatory subunit 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153261.3-132s1c1
Sequence:CCGGGAGGAGACTTACTGAATATATCTCGAGATATATTCAGTAAGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153261.3-185s1c1
Sequence:CCGGGAATGCTTCTTATAGTGGTATCTCGAGATACCACTATAAGAAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153261.3-716s1c1
Sequence:CCGGGCAGATGAAGTATGTATGTATCTCGAGATACATACATACTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153261.4-304s21c1
Sequence:CCGGTTAGCTGTATCACTCTAATAGCTCGAGCTATTAGAGTGATACAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_153261.4-1706s21c1
Sequence:CCGGTAATAGCCGCATGTACTATAACTCGAGTTATAGTACATGCGGCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153261.4-378s21c1
Sequence:CCGGGCTCGATGTCGAACGGTATTACTCGAGTAATACCGTTCGACATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153261.4-221s21c1
Sequence:CCGGTGGTGCCTGGAACTGGTTAATCTCGAGATTAACCAGTTCCAGGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029074
VALIDATED
CNEP1R1 MISSION shRNA Bacterial Glycerol Stock
CTD nuclear envelope phosphatase 1 regulatory subunit 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029074.1-1139s1c1
Sequence:CCGGGCGCCTCAGTACCTTTGATTACTCGAGTAATCAAAGGTACTGAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029074.1-265s1c1
Sequence:CCGGGCTGTATAACTCTAATAGGCTCTCGAGAGCCTATTAGAGTTATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029074.3-220s21c1
Sequence:CCGGGTGCCTGGAACTGGCTAATAGCTCGAGCTATTAGCCAGTTCCAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029074.3-417s1c1
Sequence:CCGGGATGATACAGGAAAGCTAATTCTCGAGAATTAGCTTTCCTGTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029074.3-1584s21c1
Sequence:CCGGCTCTACTTTCCTGGGTATAAACTCGAGTTTATACCCAGGAAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029074.3-258s21c1
Sequence:CCGGGTGTCCTTCTTCACGTCATTACTCGAGTAATGACGTGAAGAAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029074.3-375s21c1
Sequence:CCGGGCTCGATGTCGAACGGTATTACTCGAGTAATACCGTTCGACATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029074.3-301s21c1
Sequence:CCGGTTAGCTGTATAACTCTAATAGCTCGAGCTATTAGAGTTATACAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029074
VALIDATED
CNEP1R1 MISSION shRNA shRNA Plasmid DNA
CTD nuclear envelope phosphatase 1 regulatory subunit 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029074.1-1139s1c1
Sequence:CCGGGCGCCTCAGTACCTTTGATTACTCGAGTAATCAAAGGTACTGAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029074.1-265s1c1
Sequence:CCGGGCTGTATAACTCTAATAGGCTCTCGAGAGCCTATTAGAGTTATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029074.3-220s21c1
Sequence:CCGGGTGCCTGGAACTGGCTAATAGCTCGAGCTATTAGCCAGTTCCAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029074.3-417s1c1
Sequence:CCGGGATGATACAGGAAAGCTAATTCTCGAGAATTAGCTTTCCTGTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029074.3-1584s21c1
Sequence:CCGGCTCTACTTTCCTGGGTATAAACTCGAGTTTATACCCAGGAAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029074.3-258s21c1
Sequence:CCGGGTGTCCTTCTTCACGTCATTACTCGAGTAATGACGTGAAGAAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029074.3-375s21c1
Sequence:CCGGGCTCGATGTCGAACGGTATTACTCGAGTAATACCGTTCGACATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029074.3-301s21c1
Sequence:CCGGTTAGCTGTATAACTCTAATAGCTCGAGCTATTAGAGTTATACAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029074
VALIDATED
CNEP1R1 MISSION shRNA Lentiviral Transduction Particles
CTD nuclear envelope phosphatase 1 regulatory subunit 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029074.1-1139s1c1
Sequence:CCGGGCGCCTCAGTACCTTTGATTACTCGAGTAATCAAAGGTACTGAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029074.1-265s1c1
Sequence:CCGGGCTGTATAACTCTAATAGGCTCTCGAGAGCCTATTAGAGTTATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029074.3-220s21c1
Sequence:CCGGGTGCCTGGAACTGGCTAATAGCTCGAGCTATTAGCCAGTTCCAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029074.3-417s1c1
Sequence:CCGGGATGATACAGGAAAGCTAATTCTCGAGAATTAGCTTTCCTGTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029074.3-1584s21c1
Sequence:CCGGCTCTACTTTCCTGGGTATAAACTCGAGTTTATACCCAGGAAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029074.3-258s21c1
Sequence:CCGGGTGTCCTTCTTCACGTCATTACTCGAGTAATGACGTGAAGAAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029074.3-375s21c1
Sequence:CCGGGCTCGATGTCGAACGGTATTACTCGAGTAATACCGTTCGACATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029074.3-301s21c1
Sequence:CCGGTTAGCTGTATAACTCTAATAGCTCGAGCTATTAGAGTTATACAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks