EMAIL THIS PAGE TO A FRIEND

CNGA1

cyclic nucleotide gated channel alpha 1

Synonyms: CNCG CNCG1 CNG-1 CNG1 RCNC1 RCNCa RCNCalpha RP49
UniProtKB ID: P29973, A8K7K6, J3KPZ2, Q16279, Q16485, Q4W5E3
Gene ID:
Human(1259) Summary: The protein encoded by this gene is involved in phototransduction. Along with another protein, the encoded protein forms a cGMP-gated cation channel in the plasma membrane, allowing depolarization of rod photoreceptors. This represents the last step in the phototransduction pathway. Defects in this gene are a cause of retinitis pigmentosa autosomal recessive (ARRP) disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Mouse(12788) cyclic nucleotide gated channel alpha 1
Rat(85259) cyclic nucleotide gated channel alpha 1
sheep(101123557) cyclic nucleotide gated channel alpha 1
naked mole-rat(101699933) cyclic nucleotide gated channel alpha 1
domestic guinea pig(100720884) cyclic nucleotide gated channel alpha 1
Zebrafish(572249) cyclic nucleotide gated channel alpha 1
cow(281700) cyclic nucleotide gated channel alpha 1
Horse(100061553) cyclic nucleotide gated channel alpha 1
domestic cat(101096230) cyclic nucleotide gated channel alpha 1
dog(403891) cyclic nucleotide gated channel alpha 1
chicken(396143) cyclic nucleotide gated channel alpha 1
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000087 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000087 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000087 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007723 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007723 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007723 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054671 MISSION® esiRNA esiRNA human CNGA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000087 Rosetta Predictions human pricing
NM_053497 Rosetta Predictions rat pricing
NM_007723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203381 predicted 1401
2 SASI_Hs01_00203383 predicted 876
3 SASI_Hs01_00203384 predicted 797
4 SASI_Hs02_00301840 predicted 1679
5 SASI_Hs02_00301841 predicted 1387
6 SASI_Hs01_00203385 predicted 1996
7 SASI_Hs01_00203386 predicted 1941
8 SASI_Hs01_00203387 predicted 1665
9 SASI_Hs01_00203388 predicted 2064
10 SASI_Hs01_00203389 predicted 840
11 SASI_Hs01_00203382 predicted 1152
12 SASI_Hs01_00203390 predicted 1979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104592 predicted 1267
2 SASI_Rn02_00266103 predicted 1718
3 SASI_Rn01_00104593 predicted 1146
4 SASI_Rn01_00104594 predicted 1477
5 SASI_Rn01_00104595 predicted 846
6 SASI_Rn01_00104596 predicted 1807
7 SASI_Rn01_00104598 predicted 1558
8 SASI_Rn01_00104599 predicted 786
9 SASI_Rn02_00266104 predicted 1727
10 SASI_Rn01_00104600 predicted 1604
11 SASI_Rn01_00104597 predicted 1144
12 SASI_Rn01_00104601 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312304 predicted 1740
2 SASI_Mm02_00312305 predicted 1113
3 SASI_Mm02_00312306 predicted 2223
4 SASI_Mm02_00312307 predicted 1413
5 SASI_Mm02_00312308 predicted 1875
6 SASI_Mm02_00312309 predicted 1627
7 SASI_Mm02_00312310 predicted 313
8 SASI_Mm02_00312311 predicted 1062
9 SASI_Mm02_00312312 predicted 2061
10 SASI_Mm02_00312313 predicted 1919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000087
CNGA1 MISSION shRNA Bacterial Glycerol Stock
cyclic nucleotide gated channel alpha 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000087.3-2390s21c1
Sequence:CCGGCTATGACTGACATCAACTAAACTCGAGTTTAGTTGATGTCAGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000087.3-1942s21c1
Sequence:CCGGATCGAAGAACGGCCAATATTACTCGAGTAATATTGGCCGTTCTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000087.3-880s21c1
Sequence:CCGGACGTATCAGACATAGTCTATTCTCGAGAATAGACTATGTCTGATACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000087.1-1396s1c1
Sequence:CCGGCCTGATAAACTAAGAGCAGAACTCGAGTTCTGCTCTTAGTTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000087.1-930s1c1
Sequence:CCGGCCTTGTTATGTATATCGTCATCTCGAGATGACGATATACATAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000087.1-2026s1c1
Sequence:CCGGCCGCTTATTGACACAGAATTTCTCGAGAAATTCTGTGTCAATAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000087
CNGA1 MISSION shRNA shRNA Plasmid DNA
cyclic nucleotide gated channel alpha 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000087.3-2390s21c1
Sequence:CCGGCTATGACTGACATCAACTAAACTCGAGTTTAGTTGATGTCAGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000087.3-1942s21c1
Sequence:CCGGATCGAAGAACGGCCAATATTACTCGAGTAATATTGGCCGTTCTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000087.3-880s21c1
Sequence:CCGGACGTATCAGACATAGTCTATTCTCGAGAATAGACTATGTCTGATACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000087.1-1396s1c1
Sequence:CCGGCCTGATAAACTAAGAGCAGAACTCGAGTTCTGCTCTTAGTTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000087.1-930s1c1
Sequence:CCGGCCTTGTTATGTATATCGTCATCTCGAGATGACGATATACATAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000087.1-2026s1c1
Sequence:CCGGCCGCTTATTGACACAGAATTTCTCGAGAAATTCTGTGTCAATAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000087
CNGA1 MISSION shRNA Lentiviral Transduction Particles
cyclic nucleotide gated channel alpha 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000087.3-2390s21c1
Sequence:CCGGCTATGACTGACATCAACTAAACTCGAGTTTAGTTGATGTCAGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000087.3-1942s21c1
Sequence:CCGGATCGAAGAACGGCCAATATTACTCGAGTAATATTGGCCGTTCTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000087.3-880s21c1
Sequence:CCGGACGTATCAGACATAGTCTATTCTCGAGAATAGACTATGTCTGATACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000087.1-1396s1c1
Sequence:CCGGCCTGATAAACTAAGAGCAGAACTCGAGTTCTGCTCTTAGTTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000087.1-930s1c1
Sequence:CCGGCCTTGTTATGTATATCGTCATCTCGAGATGACGATATACATAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000087.1-2026s1c1
Sequence:CCGGCCGCTTATTGACACAGAATTTCTCGAGAAATTCTGTGTCAATAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007723
CNGA1 MISSION shRNA Bacterial Glycerol Stock
cyclic nucleotide gated channel alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007723.1-832s1c1
Sequence:CCGGGCTGTTAAGGATCTCTCGAATCTCGAGATTCGAGAGATCCTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007723.1-1934s1c1
Sequence:CCGGGCCTGTATCTTGGCTGAATATCTCGAGATATTCAGCCAAGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007723.1-1256s1c1
Sequence:CCGGGCTATCAAACAGTACATGAATCTCGAGATTCATGTACTGTTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007723.1-1382s1c1
Sequence:CCGGCCTGACAAACTAAGGGCAGAACTCGAGTTCTGCCCTTAGTTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007723.1-648s1c1
Sequence:CCGGCCGATATGTTTGTACGAACAACTCGAGTTGTTCGTACAAACATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007723
CNGA1 MISSION shRNA shRNA Plasmid DNA
cyclic nucleotide gated channel alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007723.1-832s1c1
Sequence:CCGGGCTGTTAAGGATCTCTCGAATCTCGAGATTCGAGAGATCCTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007723.1-1934s1c1
Sequence:CCGGGCCTGTATCTTGGCTGAATATCTCGAGATATTCAGCCAAGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007723.1-1256s1c1
Sequence:CCGGGCTATCAAACAGTACATGAATCTCGAGATTCATGTACTGTTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007723.1-1382s1c1
Sequence:CCGGCCTGACAAACTAAGGGCAGAACTCGAGTTCTGCCCTTAGTTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007723.1-648s1c1
Sequence:CCGGCCGATATGTTTGTACGAACAACTCGAGTTGTTCGTACAAACATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007723
CNGA1 MISSION shRNA Lentiviral Transduction Particles
cyclic nucleotide gated channel alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007723.1-832s1c1
Sequence:CCGGGCTGTTAAGGATCTCTCGAATCTCGAGATTCGAGAGATCCTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007723.1-1934s1c1
Sequence:CCGGGCCTGTATCTTGGCTGAATATCTCGAGATATTCAGCCAAGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007723.1-1256s1c1
Sequence:CCGGGCTATCAAACAGTACATGAATCTCGAGATTCATGTACTGTTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007723.1-1382s1c1
Sequence:CCGGCCTGACAAACTAAGGGCAGAACTCGAGTTCTGCCCTTAGTTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007723.1-648s1c1
Sequence:CCGGCCGATATGTTTGTACGAACAACTCGAGTTGTTCGTACAAACATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks