EMAIL THIS PAGE TO A FRIEND

CNGA2

cyclic nucleotide gated channel alpha 2

74 Gene Product Result for
Synonyms: CNCA CNCA1 CNG2 OCNC1 OCNCALPHA OCNCa
UniProtKB ID: Q16280, A0AVD0
Gene ID:
Human(1260) Summary: The protein encoded by this gene represents the alpha subunit of a cyclic nucleotide-gated olfactory channel. The encoded protein contains a carboxy-terminal leucine zipper that mediates channel formation. [provided by RefSeq, Jan 2010]
Mouse(12789) cyclic nucleotide gated channel alpha 2
Rat(25411) cyclic nucleotide gated channel alpha 2
Zebrafish(503867) cyclic nucleotide gated channel alpha 2
domestic cat(101095324) cyclic nucleotide gated channel alpha 2
cow(407172) cyclic nucleotide gated channel alpha 2
Horse(100069276) cyclic nucleotide gated channel alpha 2
dog(612414) cyclic nucleotide gated channel alpha 2
chicken(771609) cyclic nucleotide gated channel alpha 2
domestic guinea pig(100725513) cyclic nucleotide gated channel alpha 2
naked mole-rat(101721848) cyclic nucleotide gated channel alpha 2
sheep(101113826) cyclic nucleotide gated channel alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005140 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007724 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007724 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007724 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005140 Rosetta Predictions human pricing
NM_012928 Rosetta Predictions rat pricing
NM_007724 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070913 predicted 732
2 SASI_Hs02_00339068 predicted 2295
3 SASI_Hs01_00070915 predicted 2313
4 SASI_Hs01_00070916 predicted 1268
5 SASI_Hs01_00070917 predicted 1020
6 SASI_Hs01_00070918 predicted 1182
7 SASI_Hs01_00070919 predicted 2267
8 SASI_Hs01_00070920 predicted 2271
9 SASI_Hs01_00070921 predicted 492
10 SASI_Hs01_00070922 predicted 1377
11 SASI_Hs01_00070914 predicted 1461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012928 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097181 predicted 2322
2 SASI_Rn01_00097182 predicted 2284
3 SASI_Rn01_00097183 predicted 1695
4 SASI_Rn01_00097184 predicted 832
5 SASI_Rn01_00097185 predicted 1772
6 SASI_Rn01_00097186 predicted 1087
7 SASI_Rn01_00097188 predicted 1505
8 SASI_Rn01_00097189 predicted 2341
9 SASI_Rn01_00097190 predicted 760
10 SASI_Rn02_00260473 predicted 583
11 SASI_Rn01_00097187 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125224 predicted 1091
2 SASI_Mm01_00125226 predicted 2375
3 SASI_Mm01_00125227 predicted 2283
4 SASI_Mm01_00125228 predicted 1774
5 SASI_Mm01_00125229 predicted 1655
6 SASI_Mm01_00125231 predicted 2282
7 SASI_Mm01_00125232 predicted 1324
8 SASI_Mm01_00125233 predicted 1391
9 SASI_Mm02_00312314 predicted 871
10 SASI_Mm02_00312315 predicted 994
11 SASI_Mm01_00125225 predicted 844
12 SASI_Mm01_00125230 predicted 377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005140
CNGA2 MISSION shRNA Bacterial Glycerol Stock
cyclic nucleotide gated channel alpha 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005140.1-3016s1c1
Sequence:CCGGCCTTTGAACTATCTGTGGTTACTCGAGTAACCACAGATAGTTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005140.1-1443s1c1
Sequence:CCGGGCCAAGGTCATTAGGTGGTTTCTCGAGAAACCACCTAATGACCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005140.1-258s1c1
Sequence:CCGGCCAGCCAATAATCACAACCATCTCGAGATGGTTGTGATTATTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005140.1-1253s1c1
Sequence:CCGGCCCTGTAAAGGATGAGGAGTACTCGAGTACTCCTCATCCTTTACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005140.1-1917s1c1
Sequence:CCGGGATGCCAAGAAAGTCCTAGAACTCGAGTTCTAGGACTTTCTTGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005140
CNGA2 MISSION shRNA shRNA Plasmid DNA
cyclic nucleotide gated channel alpha 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005140.1-3016s1c1
Sequence:CCGGCCTTTGAACTATCTGTGGTTACTCGAGTAACCACAGATAGTTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005140.1-1443s1c1
Sequence:CCGGGCCAAGGTCATTAGGTGGTTTCTCGAGAAACCACCTAATGACCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005140.1-258s1c1
Sequence:CCGGCCAGCCAATAATCACAACCATCTCGAGATGGTTGTGATTATTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005140.1-1253s1c1
Sequence:CCGGCCCTGTAAAGGATGAGGAGTACTCGAGTACTCCTCATCCTTTACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005140.1-1917s1c1
Sequence:CCGGGATGCCAAGAAAGTCCTAGAACTCGAGTTCTAGGACTTTCTTGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005140
CNGA2 MISSION shRNA Lentiviral Transduction Particles
cyclic nucleotide gated channel alpha 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005140.1-3016s1c1
Sequence:CCGGCCTTTGAACTATCTGTGGTTACTCGAGTAACCACAGATAGTTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005140.1-1443s1c1
Sequence:CCGGGCCAAGGTCATTAGGTGGTTTCTCGAGAAACCACCTAATGACCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005140.1-258s1c1
Sequence:CCGGCCAGCCAATAATCACAACCATCTCGAGATGGTTGTGATTATTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005140.1-1253s1c1
Sequence:CCGGCCCTGTAAAGGATGAGGAGTACTCGAGTACTCCTCATCCTTTACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005140.1-1917s1c1
Sequence:CCGGGATGCCAAGAAAGTCCTAGAACTCGAGTTCTAGGACTTTCTTGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007724
CNGA2 MISSION shRNA Bacterial Glycerol Stock
cyclic nucleotide gated channel alpha 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007724.2-2749s1c1
Sequence:CCGGGCCTGTTTCCATGCACTTGTACTCGAGTACAAGTGCATGGAAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007724.2-377s1c1
Sequence:CCGGCCAGCTAATAACCATAACCATCTCGAGATGGTTATGGTTATTAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007724.2-1106s1c1
Sequence:CCGGGCCCGTATGTTTGAGTTCTTTCTCGAGAAAGAACTCAAACATACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007724.2-2114s1c1
Sequence:CCGGGCAGCTAGTATGGAGGTAGATCTCGAGATCTACCTCCATACTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007724.2-1703s1c1
Sequence:CCGGCGCATATTCCAGGATTGTGAACTCGAGTTCACAATCCTGGAATATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007724.2-1945s21c1
Sequence:CCGGCAATCGGCGCACTGCCAATATCTCGAGATATTGGCAGTGCGCCGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007724.2-1653s21c1
Sequence:CCGGTTAGGGCAGAGATAGCCATTACTCGAGTAATGGCTATCTCTGCCCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007724.2-2568s21c1
Sequence:CCGGAGGAATCAGAGAATAGCTAAACTCGAGTTTAGCTATTCTCTGATTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007724.2-1769s21c1
Sequence:CCGGTTTAGTCCTGGAGATTATATTCTCGAGAATATAATCTCCAGGACTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007724
CNGA2 MISSION shRNA shRNA Plasmid DNA
cyclic nucleotide gated channel alpha 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007724.2-2749s1c1
Sequence:CCGGGCCTGTTTCCATGCACTTGTACTCGAGTACAAGTGCATGGAAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007724.2-377s1c1
Sequence:CCGGCCAGCTAATAACCATAACCATCTCGAGATGGTTATGGTTATTAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007724.2-1106s1c1
Sequence:CCGGGCCCGTATGTTTGAGTTCTTTCTCGAGAAAGAACTCAAACATACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007724.2-2114s1c1
Sequence:CCGGGCAGCTAGTATGGAGGTAGATCTCGAGATCTACCTCCATACTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007724.2-1703s1c1
Sequence:CCGGCGCATATTCCAGGATTGTGAACTCGAGTTCACAATCCTGGAATATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007724.2-1945s21c1
Sequence:CCGGCAATCGGCGCACTGCCAATATCTCGAGATATTGGCAGTGCGCCGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007724.2-1653s21c1
Sequence:CCGGTTAGGGCAGAGATAGCCATTACTCGAGTAATGGCTATCTCTGCCCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007724.2-2568s21c1
Sequence:CCGGAGGAATCAGAGAATAGCTAAACTCGAGTTTAGCTATTCTCTGATTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007724.2-1769s21c1
Sequence:CCGGTTTAGTCCTGGAGATTATATTCTCGAGAATATAATCTCCAGGACTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007724
CNGA2 MISSION shRNA Lentiviral Transduction Particles
cyclic nucleotide gated channel alpha 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007724.2-2749s1c1
Sequence:CCGGGCCTGTTTCCATGCACTTGTACTCGAGTACAAGTGCATGGAAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007724.2-377s1c1
Sequence:CCGGCCAGCTAATAACCATAACCATCTCGAGATGGTTATGGTTATTAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007724.2-1106s1c1
Sequence:CCGGGCCCGTATGTTTGAGTTCTTTCTCGAGAAAGAACTCAAACATACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007724.2-2114s1c1
Sequence:CCGGGCAGCTAGTATGGAGGTAGATCTCGAGATCTACCTCCATACTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007724.2-1703s1c1
Sequence:CCGGCGCATATTCCAGGATTGTGAACTCGAGTTCACAATCCTGGAATATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007724.2-1945s21c1
Sequence:CCGGCAATCGGCGCACTGCCAATATCTCGAGATATTGGCAGTGCGCCGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007724.2-1653s21c1
Sequence:CCGGTTAGGGCAGAGATAGCCATTACTCGAGTAATGGCTATCTCTGCCCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007724.2-2568s21c1
Sequence:CCGGAGGAATCAGAGAATAGCTAAACTCGAGTTTAGCTATTCTCTGATTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007724.2-1769s21c1
Sequence:CCGGTTTAGTCCTGGAGATTATATTCTCGAGAATATAATCTCCAGGACTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)