EMAIL THIS PAGE TO A FRIEND

CNGA3

cyclic nucleotide gated channel alpha 3

Synonyms: ACHM2 CCNC1 CCNCa CCNCalpha CNCG3 CNG3
UniProtKB ID: Q16281, Q4VAP7, Q53RD2, Q9UP64
Gene ID:
Human(1261) Summary: This gene encodes a member of the cyclic nucleotide-gated cation channel protein family which is required for normal vision and olfactory signal transduction. Mutations in this gene are associated with achromatopsia (rod monochromacy) and color blindness. Two alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(12790) cyclic nucleotide gated channel alpha 3
Rat(85257) cyclic nucleotide gated channel alpha 3
sheep(100233164) cyclic nucleotide gated channel alpha 3
naked mole-rat(101718298) cyclic nucleotide gated channel alpha 3
domestic guinea pig(100712928) cyclic nucleotide gated channel alpha 3
chicken(396144) cyclic nucleotide gated channel alpha 3
cow(281701) cyclic nucleotide gated channel alpha 3
dog(481341) cyclic nucleotide gated channel alpha 3
domestic cat(101089848) cyclic nucleotide gated channel alpha 3
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001298 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009918 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009918 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009918 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079878 Rosetta Predictions human pricing
NM_001298 Rosetta Predictions human pricing
NM_053495 Rosetta Predictions rat pricing
NM_009918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314050 predicted 1660
2 SASI_Hs02_00314051 predicted 1473
3 SASI_Hs02_00314052 predicted 1419
4 SASI_Hs02_00314053 predicted 2520
5 SASI_Hs02_00314054 predicted 1272
6 SASI_Hs02_00314055 predicted 1485
7 SASI_Hs02_00314056 predicted 417
8 SASI_Hs02_00314057 predicted 2487
9 SASI_Hs02_00314058 predicted 1729
10 SASI_Hs02_00314059 predicted 1602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331558 predicted 1715
2 SASI_Hs01_00197660 predicted 1526
3 SASI_Hs01_00197661 predicted 1479
4 SASI_Hs02_00331559 predicted 482
5 SASI_Hs02_00331560 predicted 1722
6 SASI_Hs01_00197666 predicted 1320
7 SASI_Hs01_00197667 predicted 1546
8 SASI_Hs02_00331561 predicted 419
9 SASI_Hs02_00331562 predicted 1782
10 SASI_Hs02_00331563 predicted 1657
11 SASI_Hs01_00197662 predicted 581
12 SASI_Hs01_00197663 predicted 2197
13 SASI_Hs01_00197664 predicted 589
14 SASI_Hs01_00197665 predicted 1176
15 SASI_Hs01_00197668 predicted 383
16 SASI_Hs01_00197669 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049004 predicted 1578
2 SASI_Rn01_00049005 predicted 903
3 SASI_Rn01_00049007 predicted 499
4 SASI_Rn02_00266102 predicted 905
5 SASI_Rn01_00049008 predicted 1074
6 SASI_Rn01_00049009 predicted 1177
7 SASI_Rn01_00049010 predicted 1095
8 SASI_Rn01_00049011 predicted 321
9 SASI_Rn01_00049012 predicted 1899
10 SASI_Rn01_00049013 predicted 460
11 SASI_Rn01_00049006 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171319 predicted 375
2 SASI_Mm01_00171320 predicted 863
3 SASI_Mm01_00171321 predicted 971
4 SASI_Mm01_00171322 predicted 1434
5 SASI_Mm01_00171323 predicted 826
6 SASI_Mm01_00171324 predicted 934
7 SASI_Mm01_00171325 predicted 1675
8 SASI_Mm01_00171326 predicted 1952
9 SASI_Mm01_00171327 predicted 669
10 SASI_Mm01_00171328 predicted 964
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001298
CNGA3 MISSION shRNA Bacterial Glycerol Stock
cyclic nucleotide gated channel alpha 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001298.2-2974s21c1
Sequence:CCGGAGACAGTTTGAGGCATATTTCCTCGAGGAAATATGCCTCAAACTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001298.1-1153s1c1
Sequence:CCGGCCCGTGAAAGATGAGGAGTATCTCGAGATACTCCTCATCTTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001298.1-571s1c1
Sequence:CCGGCCTGTCTTCTATAACTGGTATCTCGAGATACCAGTTATAGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001298.1-1854s1c1
Sequence:CCGGCCTGATGAAAGACAACCTGATCTCGAGATCAGGTTGTCTTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001298.1-724s1c1
Sequence:CCGGCAAGGCTTAATGGTCAGTGATCTCGAGATCACTGACCATTAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001298.1-991s1c1
Sequence:CCGGGCCTGCATCTACTTTGCCATTCTCGAGAATGGCAAAGTAGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001298
CNGA3 MISSION shRNA shRNA Plasmid DNA
cyclic nucleotide gated channel alpha 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001298.2-2974s21c1
Sequence:CCGGAGACAGTTTGAGGCATATTTCCTCGAGGAAATATGCCTCAAACTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001298.1-1153s1c1
Sequence:CCGGCCCGTGAAAGATGAGGAGTATCTCGAGATACTCCTCATCTTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001298.1-571s1c1
Sequence:CCGGCCTGTCTTCTATAACTGGTATCTCGAGATACCAGTTATAGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001298.1-1854s1c1
Sequence:CCGGCCTGATGAAAGACAACCTGATCTCGAGATCAGGTTGTCTTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001298.1-724s1c1
Sequence:CCGGCAAGGCTTAATGGTCAGTGATCTCGAGATCACTGACCATTAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001298.1-991s1c1
Sequence:CCGGGCCTGCATCTACTTTGCCATTCTCGAGAATGGCAAAGTAGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001298
CNGA3 MISSION shRNA Lentiviral Transduction Particles
cyclic nucleotide gated channel alpha 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001298.2-2974s21c1
Sequence:CCGGAGACAGTTTGAGGCATATTTCCTCGAGGAAATATGCCTCAAACTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001298.1-1153s1c1
Sequence:CCGGCCCGTGAAAGATGAGGAGTATCTCGAGATACTCCTCATCTTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001298.1-571s1c1
Sequence:CCGGCCTGTCTTCTATAACTGGTATCTCGAGATACCAGTTATAGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001298.1-1854s1c1
Sequence:CCGGCCTGATGAAAGACAACCTGATCTCGAGATCAGGTTGTCTTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001298.1-724s1c1
Sequence:CCGGCAAGGCTTAATGGTCAGTGATCTCGAGATCACTGACCATTAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001298.1-991s1c1
Sequence:CCGGGCCTGCATCTACTTTGCCATTCTCGAGAATGGCAAAGTAGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009918
CNGA3 MISSION shRNA Bacterial Glycerol Stock
cyclic nucleotide gated channel alpha 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009918.1-1251s1c1
Sequence:CCGGCCCGTGAAAGATGAAGAGTATCTCGAGATACTCTTCATCTTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009918.1-1953s1c1
Sequence:CCGGCTGATGAAGGACAACCTAATTCTCGAGAATTAGGTTGTCCTTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009918.1-672s1c1
Sequence:CCGGGTCTTCTATAACTGGTGTCTACTCGAGTAGACACCAGTTATAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009918.1-350s1c1
Sequence:CCGGCCCGACCCAACTTTCAATAAACTCGAGTTTATTGAAAGTTGGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009918.1-909s1c1
Sequence:CCGGCCCACAGACCTGGCTTATTTACTCGAGTAAATAAGCCAGGTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009918
CNGA3 MISSION shRNA shRNA Plasmid DNA
cyclic nucleotide gated channel alpha 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009918.1-1251s1c1
Sequence:CCGGCCCGTGAAAGATGAAGAGTATCTCGAGATACTCTTCATCTTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009918.1-1953s1c1
Sequence:CCGGCTGATGAAGGACAACCTAATTCTCGAGAATTAGGTTGTCCTTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009918.1-672s1c1
Sequence:CCGGGTCTTCTATAACTGGTGTCTACTCGAGTAGACACCAGTTATAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009918.1-350s1c1
Sequence:CCGGCCCGACCCAACTTTCAATAAACTCGAGTTTATTGAAAGTTGGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009918.1-909s1c1
Sequence:CCGGCCCACAGACCTGGCTTATTTACTCGAGTAAATAAGCCAGGTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009918
CNGA3 MISSION shRNA Lentiviral Transduction Particles
cyclic nucleotide gated channel alpha 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009918.1-1251s1c1
Sequence:CCGGCCCGTGAAAGATGAAGAGTATCTCGAGATACTCTTCATCTTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009918.1-1953s1c1
Sequence:CCGGCTGATGAAGGACAACCTAATTCTCGAGAATTAGGTTGTCCTTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009918.1-672s1c1
Sequence:CCGGGTCTTCTATAACTGGTGTCTACTCGAGTAGACACCAGTTATAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009918.1-350s1c1
Sequence:CCGGCCCGACCCAACTTTCAATAAACTCGAGTTTATTGAAAGTTGGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009918.1-909s1c1
Sequence:CCGGCCCACAGACCTGGCTTATTTACTCGAGTAAATAAGCCAGGTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks