EMAIL THIS PAGE TO A FRIEND

CNGA4

cyclic nucleotide gated channel alpha 4

96 Gene Product Result for
Synonyms: CNCA2 CNG-4 CNG4 CNG5 CNGB2 OCNC2 OCNCBETA OCNCb
UniProtKB ID: Q8IV77
Gene ID:
Human(1262) Summary: CNGA4 is a modulatory subunit of vertebrate cyclic nucleotide-gated membrane channels that transduce odorant signals (Munger et al., 2001 [PubMed 11739959]
Mouse(233649) cyclic nucleotide gated channel alpha 4
Rat(85258) cyclic nucleotide gated channel alpha 4
Zebrafish(568123) cyclic nucleotide gated channel alpha 4
cow(516000) cyclic nucleotide gated channel alpha 4
Horse(100055033) cyclic nucleotide gated channel alpha 4
domestic cat(101089799) cyclic nucleotide gated channel alpha 4
dog(476830) cyclic nucleotide gated channel alpha 4
chicken(430630) cyclic nucleotide gated channel alpha 4
domestic guinea pig(100720596) cyclic nucleotide gated channel alpha 4
naked mole-rat(101697700) cyclic nucleotide gated channel alpha 4
sheep(101118637) cyclic nucleotide gated channel alpha 4
Domestic Rabbit(100358494) cyclic nucleotide gated channel alpha 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301596 ANTI-CNGA4 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037329 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_145875 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_145875 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_145875 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037329 Rosetta Predictions human pricing
XM_927349 Rosetta Predictions human pricing
NM_053496 Rosetta Predictions rat pricing
NM_001033317 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237276 predicted 941
2 SASI_Hs01_00237277 predicted 1426
3 SASI_Hs02_00308265 predicted 1670
4 SASI_Hs02_00308266 predicted 247
5 SASI_Hs01_00237278 predicted 331
6 SASI_Hs01_00237279 predicted 1207
7 SASI_Hs01_00237280 predicted 788
8 SASI_Hs02_00308267 predicted 831
9 SASI_Hs01_00237281 predicted 1219
10 SASI_Hs02_00308268 predicted 1216
11 SASI_Hs01_00237282 predicted 1009
12 SASI_Hs01_00237283 predicted 588
13 SASI_Hs01_00237284 predicted 1528
14 SASI_Hs01_00237285 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272095 predicted 1829
2 SASI_Hs01_00272096 predicted 1696
3 SASI_Hs01_00272097 predicted 1878
4 SASI_Hs01_00272098 predicted 2029
5 SASI_Hs01_00272099 predicted 2029
6 SASI_Hs01_00272100 predicted 1820
7 SASI_Hs01_00272101 predicted 1914
8 SASI_Hs01_00272102 predicted 1906
9 SASI_Hs01_00272103 predicted 1727
10 SASI_Hs01_00272104 predicted 1943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053496 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088893 predicted 410
2 SASI_Rn01_00088894 predicted 1213
3 SASI_Rn01_00088895 predicted 765
4 SASI_Rn01_00088896 predicted 520
5 SASI_Rn01_00088897 predicted 1678
6 SASI_Rn01_00088898 predicted 1400
7 SASI_Rn01_00088899 predicted 280
8 SASI_Rn01_00088900 predicted 643
9 SASI_Rn01_00088901 predicted 1374
10 SASI_Rn01_00088902 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042617 predicted 427
2 SASI_Mm01_00042618 predicted 1684
3 SASI_Mm02_00288529 predicted 1257
4 SASI_Mm01_00042619 predicted 1308
5 SASI_Mm01_00042620 predicted 540
6 SASI_Mm01_00042621 predicted 1689
7 SASI_Mm01_00042622 predicted 250
8 SASI_Mm01_00042623 predicted 1687
9 SASI_Mm01_00042624 predicted 1915
10 SASI_Mm01_00042625 predicted 424
11 SASI_Mm01_00042626 predicted 665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037329
CNGA4 MISSION shRNA Bacterial Glycerol Stock
cyclic nucleotide gated channel alpha 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000147499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037329.1-1036s1c1
Sequence:CCGGGATCAACAAGAAGATGACCAACTCGAGTTGGTCATCTTCTTGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037329.1-612s1c1
Sequence:CCGGCCAAGCTGATGCTTTACATTTCTCGAGAAATGTAAAGCATCAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037329.1-901s1c1
Sequence:CCGGCTCTGTCATCTACAACATGAACTCGAGTTCATGTTGTAGATGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037329.1-334s1c1
Sequence:CCGGCCTGCTATACCTACTAGACATCTCGAGATGTCTAGTAGGTATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037329
CNGA4 MISSION shRNA shRNA Plasmid DNA
cyclic nucleotide gated channel alpha 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000147499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037329.1-1036s1c1
Sequence:CCGGGATCAACAAGAAGATGACCAACTCGAGTTGGTCATCTTCTTGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037329.1-612s1c1
Sequence:CCGGCCAAGCTGATGCTTTACATTTCTCGAGAAATGTAAAGCATCAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037329.1-901s1c1
Sequence:CCGGCTCTGTCATCTACAACATGAACTCGAGTTCATGTTGTAGATGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037329.1-334s1c1
Sequence:CCGGCCTGCTATACCTACTAGACATCTCGAGATGTCTAGTAGGTATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037329
CNGA4 MISSION shRNA Lentiviral Transduction Particles
cyclic nucleotide gated channel alpha 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000147499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037329.1-1036s1c1
Sequence:CCGGGATCAACAAGAAGATGACCAACTCGAGTTGGTCATCTTCTTGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037329.1-612s1c1
Sequence:CCGGCCAAGCTGATGCTTTACATTTCTCGAGAAATGTAAAGCATCAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037329.1-901s1c1
Sequence:CCGGCTCTGTCATCTACAACATGAACTCGAGTTCATGTTGTAGATGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037329.1-334s1c1
Sequence:CCGGCCTGCTATACCTACTAGACATCTCGAGATGTCTAGTAGGTATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_145875
CNGA4 MISSION shRNA Bacterial Glycerol Stock
cyclic nucleotide gated channel alpha 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145875.1-129s1c1
Sequence:CCGGCCCAATCATGTATAATCTCATCTCGAGATGAGATTATACATGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145875.1-648s1c1
Sequence:CCGGCCAGTATCTCTACAGCTTCTACTCGAGTAGAAGCTGTAGAGATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145875.1-508s1c1
Sequence:CCGGGCCAAGCTGATGATCTACATTCTCGAGAATGTAGATCATCAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145875.1-231s1c1
Sequence:CCGGCCTGCTGTACCTACTAGATATCTCGAGATATCTAGTAGGTACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145875.1-1560s1c1
Sequence:CCGGCAGCGCACTGAAGATAGCTTACTCGAGTAAGCTATCTTCAGTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_145875
CNGA4 MISSION shRNA shRNA Plasmid DNA
cyclic nucleotide gated channel alpha 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145875.1-129s1c1
Sequence:CCGGCCCAATCATGTATAATCTCATCTCGAGATGAGATTATACATGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145875.1-648s1c1
Sequence:CCGGCCAGTATCTCTACAGCTTCTACTCGAGTAGAAGCTGTAGAGATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145875.1-508s1c1
Sequence:CCGGGCCAAGCTGATGATCTACATTCTCGAGAATGTAGATCATCAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145875.1-231s1c1
Sequence:CCGGCCTGCTGTACCTACTAGATATCTCGAGATATCTAGTAGGTACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145875.1-1560s1c1
Sequence:CCGGCAGCGCACTGAAGATAGCTTACTCGAGTAAGCTATCTTCAGTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_145875
CNGA4 MISSION shRNA Lentiviral Transduction Particles
cyclic nucleotide gated channel alpha 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145875.1-129s1c1
Sequence:CCGGCCCAATCATGTATAATCTCATCTCGAGATGAGATTATACATGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145875.1-648s1c1
Sequence:CCGGCCAGTATCTCTACAGCTTCTACTCGAGTAGAAGCTGTAGAGATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145875.1-508s1c1
Sequence:CCGGGCCAAGCTGATGATCTACATTCTCGAGAATGTAGATCATCAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145875.1-231s1c1
Sequence:CCGGCCTGCTGTACCTACTAGATATCTCGAGATATCTAGTAGGTACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145875.1-1560s1c1
Sequence:CCGGCAGCGCACTGAAGATAGCTTACTCGAGTAAGCTATCTTCAGTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks