EMAIL THIS PAGE TO A FRIEND

CNGB1

cyclic nucleotide gated channel beta 1

Synonyms: CNCG2 CNCG3L CNCG4 CNG4 CNGB1B GAR1 GARP RCNC2 RCNCb RCNCbeta RP45
UniProtKB ID: Q14028, O43636, Q13059, Q14029, Q9UMG2
Gene ID:
Human(1258) Summary: In humans, the rod photoreceptor cGMP-gated cation channel helps regulate ion flow into the rod photoreceptor outer segment in response to light-induced alteration of the levels of intracellular cGMP. This channel consists of two subunits, alpha and beta, with the protein encoded by this gene representing the beta subunit. Defects in this gene are a cause of cause of retinitis pigmentosa type 45. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Mouse(333329) cyclic nucleotide gated channel beta 1
Rat(83686) cyclic nucleotide gated channel beta 1
chicken(768759) cyclic nucleotide gated channel beta 1
domestic cat(101092568) cyclic nucleotide gated channel beta 1
cow(281702) cyclic nucleotide gated channel beta 1
Horse(100062786) cyclic nucleotide gated channel beta 1
dog(611173) cyclic nucleotide gated channel beta 1
sheep(101121447) cyclic nucleotide gated channel beta 1
naked mole-rat(101709810) cyclic nucleotide gated channel beta 1
domestic guinea pig(100714217) cyclic nucleotide gated channel beta 1
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_286113 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_286113 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_286113 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001297 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001297 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001297 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU161021 MISSION® esiRNA esiRNA human CNGB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001297 Rosetta Predictions human pricing
NM_031809 Rosetta Predictions rat pricing
XM_001476198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053368 predicted 3268
2 SASI_Hs01_00053369 predicted 397
3 SASI_Hs01_00053370 predicted 1809
4 SASI_Hs01_00053371 predicted 2915
5 SASI_Hs01_00053372 predicted 2168
6 SASI_Hs01_00053373 predicted 1616
7 SASI_Hs01_00053374 predicted 3115
8 SASI_Hs01_00053375 predicted 1995
9 SASI_Hs02_00331557 predicted 370
10 SASI_Hs01_00053377 predicted 2719
11 SASI_Hs01_00053376 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031809 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050603 predicted 2510
2 SASI_Rn01_00050605 predicted 2098
3 SASI_Rn01_00050606 predicted 3014
4 SASI_Rn01_00050607 predicted 2537
5 SASI_Rn01_00050608 predicted 3406
6 SASI_Rn01_00050609 predicted 3495
7 SASI_Rn01_00050611 predicted 2734
8 SASI_Rn02_00265266 predicted 2449
9 SASI_Rn01_00050612 predicted 3405
10 SASI_Rn02_00265267 predicted 3115
11 SASI_Rn01_00050604 predicted 3207
12 SASI_Rn01_00050610 predicted 2846
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00387559 predicted 2910
2 SASI_Mm02_00387560 predicted 1916
3 SASI_Mm02_00387561 predicted 2908
4 SASI_Mm02_00387562 predicted 3230
5 SASI_Mm02_00387563 predicted 2074
6 SASI_Mm02_00387564 predicted 3211
7 SASI_Mm02_00387565 predicted 456
8 SASI_Mm02_00387566 predicted 3222
9 SASI_Mm02_00387567 predicted 2280
10 SASI_Mm02_00387568 predicted 2472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_286113
CNGB1 MISSION shRNA Bacterial Glycerol Stock
cyclic nucleotide gated channel beta 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286113.2-1401s1c1
Sequence:CCGGCCTGAAGTACATGGCCTTCTTCTCGAGAAGAAGGCCATGTACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286113.2-2175s1c1
Sequence:CCGGCGGATCGGTGTTTGGAGAAATCTCGAGATTTCTCCAAACACCGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286113.2-1341s1c1
Sequence:CCGGGCCCTTGGACTTTCTCTACTTCTCGAGAAGTAGAGAAAGTCCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286113.2-360s1c1
Sequence:CCGGGCCAGAAGAGAAAGAGGAGAACTCGAGTTCTCCTCTTTCTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286113.2-1449s1c1
Sequence:CCGGCCTCAGCAAAGCCTACGTTTACTCGAGTAAACGTAGGCTTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_286113
CNGB1 MISSION shRNA shRNA Plasmid DNA
cyclic nucleotide gated channel beta 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286113.2-1401s1c1
Sequence:CCGGCCTGAAGTACATGGCCTTCTTCTCGAGAAGAAGGCCATGTACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286113.2-2175s1c1
Sequence:CCGGCGGATCGGTGTTTGGAGAAATCTCGAGATTTCTCCAAACACCGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286113.2-1341s1c1
Sequence:CCGGGCCCTTGGACTTTCTCTACTTCTCGAGAAGTAGAGAAAGTCCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286113.2-360s1c1
Sequence:CCGGGCCAGAAGAGAAAGAGGAGAACTCGAGTTCTCCTCTTTCTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286113.2-1449s1c1
Sequence:CCGGCCTCAGCAAAGCCTACGTTTACTCGAGTAAACGTAGGCTTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_286113
CNGB1 MISSION shRNA Lentiviral Transduction Particles
cyclic nucleotide gated channel beta 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286113.2-1401s1c1
Sequence:CCGGCCTGAAGTACATGGCCTTCTTCTCGAGAAGAAGGCCATGTACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286113.2-2175s1c1
Sequence:CCGGCGGATCGGTGTTTGGAGAAATCTCGAGATTTCTCCAAACACCGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286113.2-1341s1c1
Sequence:CCGGGCCCTTGGACTTTCTCTACTTCTCGAGAAGTAGAGAAAGTCCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286113.2-360s1c1
Sequence:CCGGGCCAGAAGAGAAAGAGGAGAACTCGAGTTCTCCTCTTTCTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_286113.2-1449s1c1
Sequence:CCGGCCTCAGCAAAGCCTACGTTTACTCGAGTAAACGTAGGCTTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001297
CNGB1 MISSION shRNA Bacterial Glycerol Stock
cyclic nucleotide gated channel beta 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001297.1-3388s1c1
Sequence:CCGGCCTCGCTATGACAGGAAAGATCTCGAGATCTTTCCTGTCATAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001297.1-2606s1c1
Sequence:CCGGCCCAAGACACTCTTTGAAATTCTCGAGAATTTCAAAGAGTGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001297.4-2656s21c1
Sequence:CCGGATTATTTCACGGGCGTCTTTGCTCGAGCAAAGACGCCCGTGAAATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001297.4-4051s21c1
Sequence:CCGGCCTGAGCTCTCACTATCATTTCTCGAGAAATGATAGTGAGAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001297.4-2560s21c1
Sequence:CCGGATATTCGCTGTTACTACTTTGCTCGAGCAAAGTAGTAACAGCGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001297.4-2371s21c1
Sequence:CCGGACATGGCCTTCTTCGAGTTTACTCGAGTAAACTCGAAGAAGGCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001297
CNGB1 MISSION shRNA shRNA Plasmid DNA
cyclic nucleotide gated channel beta 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001297.1-3388s1c1
Sequence:CCGGCCTCGCTATGACAGGAAAGATCTCGAGATCTTTCCTGTCATAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001297.1-2606s1c1
Sequence:CCGGCCCAAGACACTCTTTGAAATTCTCGAGAATTTCAAAGAGTGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001297.4-2656s21c1
Sequence:CCGGATTATTTCACGGGCGTCTTTGCTCGAGCAAAGACGCCCGTGAAATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001297.4-4051s21c1
Sequence:CCGGCCTGAGCTCTCACTATCATTTCTCGAGAAATGATAGTGAGAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001297.4-2560s21c1
Sequence:CCGGATATTCGCTGTTACTACTTTGCTCGAGCAAAGTAGTAACAGCGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001297.4-2371s21c1
Sequence:CCGGACATGGCCTTCTTCGAGTTTACTCGAGTAAACTCGAAGAAGGCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001297
CNGB1 MISSION shRNA Lentiviral Transduction Particles
cyclic nucleotide gated channel beta 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001297.1-3388s1c1
Sequence:CCGGCCTCGCTATGACAGGAAAGATCTCGAGATCTTTCCTGTCATAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001297.1-2606s1c1
Sequence:CCGGCCCAAGACACTCTTTGAAATTCTCGAGAATTTCAAAGAGTGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001297.4-2656s21c1
Sequence:CCGGATTATTTCACGGGCGTCTTTGCTCGAGCAAAGACGCCCGTGAAATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001297.4-4051s21c1
Sequence:CCGGCCTGAGCTCTCACTATCATTTCTCGAGAAATGATAGTGAGAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001297.4-2560s21c1
Sequence:CCGGATATTCGCTGTTACTACTTTGCTCGAGCAAAGTAGTAACAGCGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001297.4-2371s21c1
Sequence:CCGGACATGGCCTTCTTCGAGTTTACTCGAGTAAACTCGAAGAAGGCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks